a 6 1 secretary of interior apos s standards a4

... -Revised all sections of the research paper March -Revised all sections of the research paper -Wrote abstract April -Finalized all sections of the research paper -Assembled all parts of the paper ... partial drawings on the blackboard that lacked detail: a drawing of a person wearing a skirt and T-shirt, a person wearing jeans and a T-shirt, and a landscape horizon with a fading roadway Students ... class As students show gains, the transfer or the ‘hand-over phase‘, termed by Jerome Bruner is evident This is a time “when an adult intervenes and gradually provides less assistance to a learner”...

Ngày tải lên: 24/02/2014, 18:20

... benefits that physical design brings to the design process As a class, discuss the possible risks involved in not completing a physical design The instructor will write your answers on a flip chart ... Activity 6. 1: Risks of Skipping Physical Design Exercise 1: Identifying Potential Risks of Not Doing Physical Design ! Identify the risks of skipping the physical design Consider the benefits...

Ngày tải lên: 10/12/2013, 16:16

... PIPER ALPHA OIL SPILL LANDMARK DISASTER NATURAL DISASTER HEALTH & DISEASE HEALTH & DISEASE HEALTH & DISEASE HEALTH & DISEASE SICKNESS DISEASE/ SICKNESS SERIOUS ILLNESS DISEASE TO THE OIL INDUSTRY ... threads involving the use of a series of landmark disasters (ranging from Hurricane Katrina, 9 /11 to other significant nuclear, man-made or large-scale natural disasters) as common source domains ... “Environment”/ “Katrina”/ “9 /11 ”) – BP OIL SPILL TARGET DOMAINS (ENTITIES/ EVENTS) NYT-Corpus WP-Corpus G-Corpus TT-corpus LANDMARK DISASTERS: LANDMARK DISASTERS: LANDMARK DISASTERS: LANDMARK DISASTERS: NUCLEAR...

Ngày tải lên: 10/09/2015, 09:22

... 90 90 90 90 90 90 90 90 90 Tbj 46 46 46 46 16 3 16 3 16 3 16 3 15 1 15 1 15 1 15 1 ft 11 25 50 39 26 48 29 45 60 17 fl = T ai.T bj TS ( f t − f l )2 f l 11 .5 11 .5 11 .5 11 .5 40.75 40.75 40.75 40.75 37.75 ... THE MODEL SECTION - VARIATE DKCR GRAND MEAN (N= 12 ) NO OBS 12 1. 9058 STANDARD DEVIATION C OF V |LN SD/MEAN | BASED ON BASED ON % | TOTAL SS RESID SS | 0. 2 61 62 0.5 565 3E- 01 2.9 0.0547 ... 14 5,2 15 7 ,6 688,7 349 ,6 502,8 347 ,6 348 232,9 4 71, 9 1 06, 6 16 , 6 10 ,6 18 ,6 8,9 53 ,1 Nhiệt độ (0C) 2008 2009 2 010 15 ,9 16 , 2 18 ,3 13 ,5 22 20,7 20 ,1 20,8 21, 4 24,3 24 ,1 23 26, 7 26, 7 28,2 28 ,1 30 30,6...

Ngày tải lên: 31/10/2012, 10:20

... CHAPTER INTRODUCTION of Some Linguistic Features of Barack Obama s English Speeches” 1. 2 AIMS AND OBJECTIVES 1. 2 .1 Aims This study aims at analyzing the stylistic features of Barack Obama s English ... What are the stylistic features of Barack Obama s English speeches? - What are some suggestions for teaching and learning English as well as writing speeches, especially political speeches? 1. 5 ... there for America” [19 ] 13 14 Here, America is pictured as a person who has a morality which is based on ideas of fairness, an equitable person 4 .1. 7 The State as a Family In the following example,...

Ngày tải lên: 26/11/2013, 13:21

Ngày tải lên: 22/12/2013, 02:17

... can be of use." "Oh, a trusty comrade is always of use; and a chronicler still more so My room at The Cedars is a double-bedded one." "The Cedars?" "Yes; that is Mr St Clair 's house I am staying ... the 5 :14 from Cannon Street every night Mr St Clair is now thirty-seven years of age, is a man of temperate habits, a good husband, a very affectionate father, and a man who is popular with all ... fringe of the belt of suburban villas, when he shook himself, shrugged his shoulders, and lit up his pipe with the air of a man who has satisfied himself that he is acting for the best "You have a...

Ngày tải lên: 24/12/2013, 20:15

... knowledge of the non sinusoidal permanent magnet synchronous motor We are so able as well to analyse the classical control laws such as 12 0' voltage control for example, as to deduce of this new ... so a transformation that we can consider as an extension of the Park 's transformation for the synchronous machines with backelectromotive forces of any pattem With this new transformation a vector ... 33 PROPOSAL OF AN EXTENSION OF THE PARK 'S TRANSFORMATION Classical Park 's transformation is in fact the succession of two transfomations The torque is then given by: T, = p.(@~,.io+@'did+@'q.iq)...

Ngày tải lên: 03/01/2014, 19:50

... - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ # ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C) ... ! ; * ;< A A 7; * A ;< A ! # , # ' * D E # * # # # # # * % % ) #0 ) # # ; "" # $% """ % &' () ' ;< * &'F A E G &'&0 A &'40 # &'( E G* &'&0 * # A % &'&) E < % &H() A % %4FF ) G % &'&) A ) %4FF...

Ngày tải lên: 29/01/2014, 00:23

... Fair 36 or 462 15 60 2 16 16 18 16 28 16 14 20 20 17 or 212 16 15 26 ( 16 ) 20 14 14 2 18 18 17 28 16 39 (13 ) 18 12 14 24 20 10 0, 80% 10 0% 80% † 10 0% 10 0% 10 0% 10 0% 60 % 10 0% † 10 0% † 10 0% 10 0% 10 0, ... Africa Libya 20 Moldova 40% Bangladesh Pakistan Nigeria Azerbajan Senegal Bolivia Gambia Vietnam 10 Nepal Equatorial Guinea Ghana India Ethiopia Indonesia 40 Madagascar Malawi Niger Guatemala Brazil ... Sudan and South Sudan* 35% 2,200 16 31 39% 2,500 13 51 1 41 10 Uganda 14 0 11 Bangladesh 41% 6, 10 0 22 13 3 12 Tanzania 43% 3,400 10 45 Total lives saved: 1. 3 million — * Data are for the Sudan prior...

Ngày tải lên: 12/02/2014, 11:20

Ngày tải lên: 12/02/2014, 12:01

... 69 94 10 3 10 3 10 4 11 0 11 8 13 7 15 1 15 1 16 0 19 7 217 * 702 Department of Navy General Services Administration Small Business Administration Federal Emergency Management Agency Department of Interior ... business days, and two requests are still pending over 750 business days later The range for the sensitive unclassified information requests was 6- 1 86 business days, and nine requests are still ... Information Systems Agency, “DMS GENSER Message Security Classifications, Categories, and Marking Phrase Requirements,” Version 1. 2, Attachment (Mar 19 , 19 99) 12 Id at 6- 7 13 Id at 14 Id at 12 15 http://www.openthegovernment.org/otg/SRC2005.pdf...

Ngày tải lên: 18/02/2014, 05:20

... AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT ... urea Mass spectrometry, amino acid analysis and sequencing Amino acid analysis was performed at the Amino Acid Analysis Center, University of Uppsala, Sweden Sequence analysis was performed using ... gels (A, C) and 1% agarose gels (B,D), and proteins were visualized by Coomassie stain Lanes HS and LS are molecular mass standards, with the molecular mass in kDa given on the left (E) 1% agarose...

Ngày tải lên: 18/02/2014, 13:20

... F12 8A S1 2 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) 74 91 80 59 74 51 ... PAI -1( V12 6A) , PAI -1( F12 8A) , PAI -1( I13 7A) , PAI -1( I13 8A) , PAI -1( N13 9A) , PAI -1( W14 1A) , PAI1(T14 6A) and PAI -1( M149K) Structural analysis Structural analysis was based on the following depositions in ... native PAI -1 This analysis showed that the substitutions F10 0A, V12 6A, F12 8A, I13 7A, N13 9A, W14 1A, T14 6A and N15 2A increased the fraction of PAI -1 molecules behaving as a Fig Reaction products...

Ngày tải lên: 20/02/2014, 11:20

... composed of 10 sergeants, 10 corporals, 39 artificers, 39 second class privates, and musicians; all with higher pay than that of enlisted men in the line of the army Captain Swift was assigned ... Military Academy, was assigned as junior officer of the company At that time I had been an officer of engineers for four years; my rank was that of second lieutenant All the first lieutenants, and ... balls close about our heads This fire was soon understood to come from our Naval gunboats, and aimed at small parties of Mexican lookouts on shore No resistance was made to the landing of Worth's...

Ngày tải lên: 21/02/2014, 08:20