... leaves and F became stable Shoot resistance was computed from: where P was the applied water pressure, and A was the total leaf area of the shoots measured with a delta-T leaf area meter (Delta-T ... al, 1993) and for Acer saccharum and Populus deltoides (Tyree and Alexander, unpublished data) The leaf-blade resistance includes vascular and nonvascular pathways from the base of the leaves to ... water across a length of stem segment via water-filled tubing to a container of water on a balance Flow rate, F, was adjusted to differ- ent values measuring by changing the air pressure in R and...
Ngày tải lên: 08/08/2014, 23:22
... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 273-284 49 Powell SN and Bindra RS Targeting the DNA damage response for cancer therapy DNA Repair (Amst) 2009; 8: 1153-1165 50 Shimada M and Nakanishi M DNA damage checkpoints and cancer J Mol Histol...
Ngày tải lên: 26/10/2012, 09:48
Báo cáo Y học: Substrates modulate the rate-determining step for CO binding in cytochrome P450cam (CYP101) A high-pressure stopped-flow study pdf
... regression analysis: slow phase (0.92 for P < 1200 bar, 0.75 for P > 1200 bar); fast phase (0.72 for P < 100 0 bar, 0.93 for P > 100 0 bar) Table the water influx rate is clearly smaller for substrate ... activation entropy in substrate-free P450cam may indicate that the CO molecule travels along many pathways to the heme iron Along each pathway, however, many contacts (e.g contacts to many water ... simplest approximation we used a linear combination of two bimolecular processes to fit the curves At bar the fractions of the slow and the fast phases are approximately equal For the camphane complex...
Ngày tải lên: 08/03/2014, 23:20
A Database and Evaluation Methodology for Optical Flow pdf
... which algorithms 2.6 Databases and Evaluations Database Design Prior to our evaluation (Baker et al 2007), there were three major attempts to quantitatively evaluate optical flow algo- Creating a ... sparsely allocates states across space and for the possible flows at each spatial location The spatial allocation uses a hierarchy of segmentations, with a single possible flow for each segment at each ... of flow parameters, say (udata , vdata ) for the data term and (uprior , vprior ) for the prior: EGlobal = EData (udata , vdata ) + λEPrior (uprior , vprior ) +γ udata − uprior + vdata − vprior...
Ngày tải lên: 17/03/2014, 00:20
10 Cash flow strategies for a successful business docx
... how both can have a major impact on profit and cash flow For example, a retailer increased the amount of stock on hand and sales increased dramatically when customers saw the availability of ... owners that they have a tax problem when they in fact have a cash flow problem Work out how much tax you paid in the previous year as a percentage of sales If the tax paid was 10% of your sales then ... Brisbane, Australia He has worked with small and medium sized businesses both in Australia and internationally since 1994 He is a qualified CPA and recently completed a Master of Business Administration...
Ngày tải lên: 27/06/2014, 17:20
Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx
... first, ADHR1 was preincubated for 10 with MgCl2 before addition of adenine and application of pressure In the second, ADHR1 was preincubated with adenine for 10 before addition of MgCl2 and application ... by an abasic analog [27] It was observed that 2,6-diaminopurine was significantly more efficient than adenine in restoring the catalytic activity In an attempt to obtain additional information about ... hydrostatic pressure on the catalytic activity of ADHR1 Cleavage kinetics are shown for the reaction at atmospheric pressure (d) and at 150 MPa (h) After h of reaction under pressure, the reaction...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, which is not a substrate ... standard error, n ¼ Lys[Z(NO2)]-Val, Lys(4-nitrobenzyloxycarbonyl)-Val Compound Bip-[3H]Pro uptake (%) Control Gly Gly-Sar Bip-Pro Ala-Ala Pro-Ala Lys-Lys Ala-Asp D-Phe-Ala Ala-Ala-Ala d-Aminolevulinic ... [Gly1-14C]Gly-Sar (specific radioactivity 53 mCiÆ mmol)1) was custom synthesized by Amersham International (Little Chalfont, UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/or ADP/Pi binding to the tetraprotomeric form of Na/KATPase accompanying ... of K+-activated phosphatase at 0.1 MPa for BIPM and FITC was taken as 100 % Based on three independent experiments, the means and standard deviations are shown by error bars 114 M Kato et al (Eur ... in the pressure range studied can be explained as a change in the Na+/K+ATPase-lipid bilayer system That is, a high pressure of 100 ± 220 MPa causes dissociation of a and b subunits, disassembly...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx
... ATCCAGTGTGAGGGG-3¢ (L9 3A s), 5¢-CCCCTCACA CTGGATGCGCGCGTTCTTGGTCCCAGACTG-3¢ (L9 3A as), 5¢-GTCTGGGACCAAGAACCTGGAAAT CCAGTGTGAGGGGGGCAGC-3¢ (R94E s), 5¢-GCTG CCCCCCTCACACTGGATTTCCAGGTTCTTGGTCC CAGAC-3¢ ... TCGCCGACGGTCACTGCGCTCCAGTAG-3¢ (G53V as), 5¢-GACCGGCGGCGAGGCGAACGCGCTGCTC AGTGCCGAGCCCG-3¢ (L5 8A s), 5¢-CGGGCTCGGC ACTGAGCAGCGCGTTCGCCTCGCCGCCGGTC-3¢ (L5 8A as), 85¢-CAGTCTGGGACCAAGAACGCGCGC ATCCAGTGTGAGGGG-3¢ ... (pET32-hSOCS-3) Flanking primer sequences for PCR were as follows: 5¢-CCATGGTCACCCACAGCAAGTTT-3¢ and 5¢-TGG ACCAGTACGATGCCCCGCTTTAATGAATTC-3¢ For the expression in COS7 cells, human SOCS-3 cDNA was subcloned...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite ... Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a- Amylase Barley (AMY1) Barley (AMY2) Rice ( 2A) Maize ... substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and (i.e domain B) from AMY2...
Ngày tải lên: 31/03/2014, 08:20
high precision dynamic alignment and gap control for optical near field nanolithography
... lithography process, and to realize parallel nanopatterning and move toward scalable parallel lithography We demonstrate parallel lithography results using a 5Â5 array of bowtie aperture antennas as ... interferometric-spatial-phase-imaging (ISPI) to control a gap distance of the order of nanometers for parallel optical near-field nanolithography In optical nearfield nanolithography, the distance between the optical ... alignment As mentioned before, for near-field optical nanolithography, the alignment between the mask and the substrate is critical For parallel lithography using multiple antennas, it After aligning...
Ngày tải lên: 06/05/2014, 08:53
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
... MART-1 100 101 102 CD8 FITC 103 104 100 101 102 CD8 FITC 103 104 100 101 102 CD8 FITC 103 104 100 101 102 CD8 FITC 103 104 CD8 FITC Figure MART-17tetramer positive cells detected in a melanoma ... PBMC assay) were analyzed by two analysts each performed eight intra-day assays and 10 inter-day assays Cells were stimulated with relevant peptide (gp100209 and gp100pool to TIL1520 and MART-1 ... tetramer data LA, acquired and analyzed RT-PCR data KS, acquired and analyzed ELISPOT data MAP, supervised pre-validation studies for tetramer, RT-PCR, and ELISPOT and assisted writing the manuscript...
Ngày tải lên: 18/06/2014, 15:20
A Practical Guide to Particle Counting for Drinking Water Treatment - Chapter 10 ppt
... communications: Transmission of digital data in a sequential format Several units can communicate over a single cable C SCADA INTERFACE SCADA (Supervisory Control and Automated Data Acquisition) systems are ... more particle size ranges, each a separate data point Most particle counters accommodate analog and discrete inputs, which will create yet another string of data There are status and alarm points, ... of a few of them is provided below: Dynamic Data Exchange (DDE) Dynamic Data Exchange is what the name implies, a constant “exchange” of data between the particle counter software package and a...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Modified femoral pressuriser generates a longer lasting high pressure during cement pressurisation" pot
... Ten Sawbones® proximal femora were prepared based on standard operative procedures The femoral neck osteotomy was standardised to a cut at 20 mm from the lesser trochanter The femoral canal was ... durations when different pressure thresholds were exceeded (100 , 150, 200, 250 and 300 kPa) were analysed Statistic analysis was performed using student’s ttest for peak pressure and Two-way ANOVA ... or a more open area such as the acetabulum [18] The conventional pressuriser tested here can reach a high pressure, nearly 300 kPa (2256 mmHg), but due to cement leakage did not retain this pressure...
Ngày tải lên: 20/06/2014, 07:20
A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation_2 docx
... compressor are investigated to study the effects of inlet parameters on the compressor performance and characteristics Figure 4.16 indicates that a smaller inlet flow angle causes a higher total pressure ... 4.14 and Fig 4.15 Both figures illustrate that for a higher inlet flow angle, more severe distortion propagation occurs with a larger inlet size of distorted region On the contrary, for a lower ... induces a larger propagation of inlet distortion Because a small inlet incident angle induces a large vertical flow in distorted region as shown in Fig 4.7, thus induces a small axial distorted velocity...
Ngày tải lên: 21/06/2014, 21:20
Báo cáo hóa học: "Research Article Design Flow Instantiation for Run-Time Reconfigurable Systems: A Case Study" pot
... features were taken into account It uses 384 kbits/s user data rate without handover The functions are an adaptive filter, a channel estimator, a multipath combiner, and a correlator bank The adaptive ... identified There are some rules of thumb that can be applied If an application has roughly several samesized hardware accelerators that are not used at the same time, these accelerators can be implemented ... synthesis-based HW estimator (ASAP & ALAP, modified FDS, allocation) Figure 4: The estimation framework 4.1.1 High- level synthesis-based hardware estimation A graphical view of the hardware estimation...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo hóa học: " Research Article DART: A Functional-Level Reconfigurable Architecture for High Energy Efficiency" potx
... elements (PAEs) PAEs are specialized for algorithms of a particular domain on a specific XPP processor core The XPP processor is hierarchical, and a cluster contains a 2D array of PAEs, which can support ... Italy, May 1999 [27] T Ojanpera and R Prasad, Wideband CDMA for Third Generation Mobile Communications, Artech House, Norwood, Mass, USA, 1998 [28] E H Dinan and B Jabbari, “Spreading codes for ... Thanks to this network, resources can communicate with each other in the RDP Furthermore, the datapath can be optimized for several kinds of calculation patterns and can make data sharing easier...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " Research Article Design Flow Instantiation for Run-Time Reconfigurable Systems: A Case Study" potx
... features were taken into account It uses 384 kbits/s user data rate without handover The functions are an adaptive filter, a channel estimator, a multipath combiner, and a correlator bank The adaptive ... identified There are some rules of thumb that can be applied If an application has roughly several samesized hardware accelerators that are not used at the same time, these accelerators can be implemented ... synthesis-based HW estimator (ASAP & ALAP, modified FDS, allocation) Figure 4: The estimation framework 4.1.1 High- level synthesis-based hardware estimation A graphical view of the hardware estimation...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " A Novel High-Speed Configurable Viterbi Decoder for Broadband Access" doc
... number Table 10 shows the resulting survivor data arrangement in DpRAM Because the data format is the same for any iteration, Table 10 only gives the data arrangement for one iteration Let I be a 9-bit ... states, λmax is maximum BM, and k is and for radix-2 ACS and radix-4 ACS, respectively Hence, for a maximum constraint length 10 and radix-2 ACS with 3-bit quantisation, N = 512, k = 1, and λmax ... while for DpRAM4 to DpRAM7, the path Table 4: State arrangement and in-place path metric updating Iteration Address (DpRAM0–7) DpRAM0 BF0 DpRAM1 DpRAM2 BF1 DpRAM3 DpRAM4 BF2 DpRAM5 DpRAM6 BF3 DpRAM7...
Ngày tải lên: 23/06/2014, 01:20