9 framework of a typically successful energy efficiency program

Tài liệu 7 Habits of a Highly Successful Trader doc

Tài liệu 7 Habits of a Highly Successful Trader doc

... you are simply chasing the money it can be a motivation as long as you are motivated to learn and work at what really works in the market and NOT keep chasing the latest hot new trading idea that ... you are a long term trend follower then why ask a day trader? If you are a value investor then asking a momentum trader will be a total waste of time What I am saying is, no two people have the ... playing simulation games so as to get a feel for how money management plays such an important role and for you to get a feel for how any game of chance can and will have streaks This is what i from...

Ngày tải lên: 13/12/2013, 00:15

31 470 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... include: Friends of the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society,...

Ngày tải lên: 06/03/2014, 15:21

88 583 0
Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

... was made with a beater before 30 years After that, a larger capacity and labor saving requirement of a paper making machine follows a continuous beating machine, that is a rifiner The types of ... Paper and Pulp Technology Association Table Steam and electric power unit consumption rate for the paper and cardboard manufacturing process in Japan Printing paper and coated manila board are ... gives the material balance and water balance around the papermaking machine in terms of model (wrapping paper of 55 g/m2, with the daily production of 100 tons, and total efficiency of 100%) When...

Ngày tải lên: 09/03/2014, 00:20

45 1,4K 0
Báo cáo hóa học: " Evaluation of a TDMA-based energy efficient MAC protocol for multiple capsule networks" pot

Báo cáo hóa học: " Evaluation of a TDMA-based energy efficient MAC protocol for multiple capsule networks" pot

... S-MAC [6], T-MAC [10] are examples of typical contention-based MAC protocols They offer the advantages of simplicity, small overhead, small latency, etc TRAMA [11] and LMAC [12] are typical schedule-based ... disparate sampling rate and sample data size For example, the pressure and temperature sampled data may be smaller in size and lower in sampling rate than the real time image data Finally, unlike ... http://jwcn.eurasipjournals.com/content/2011/1/54 Page of 12 Table Parameters for evaluating the multi-hop communications Parameters Value Parameters Area Straight line of 30 cm Inefficiency factor a Value...

Ngày tải lên: 21/06/2014, 01:20

12 275 0
Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam

Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam

... voluntary factors such as bad personal habits (cigarette smoking, and alcohol consumption), fatty diet, and sexual behavior and involuntary factors such as UV exposure, polluted air and contaminated ... metastasize to distant organ sites (1-5) There are five main therapies for cancer treatment: chemotherapy, radiotherapy, surgery, and targeted therapy Chemotherapy and radiotherapy are the use of ... drastically reduced and overall health will improve The power of cancer surveillance and research in America Although the association of lung cancer with smoking is a perfect example for attacking...

Ngày tải lên: 20/06/2016, 23:20

7 462 0
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

... (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance is the farad; farad = coulomb per volt; typical capacitances are measured in microfarads or picofarads) ... 3B37 3A2 8 3B49 3B50 3A2 6 3B53 3A2 7 Controller 3A3 1 3A2 2 3A2 3 3A1 4 3A1 1 3A1 9 3B51 3B54 3A2 0 3A7 3B35 3B38 3A4 3A1 3A1 0 3A1 5 3A8 3A1 6 3B42 3B46 3A2 1 3A1 8 3A9 3A2 3A6 3A3 Figure 12: Spatial distribution ... 3A7 3A4 3A1 3A1 0 3A1 5 3A8 3A1 6 3A9 3A2 3A6 3A3 Figure 13: Spatial distribution of the individual success rate in the Castalia simulator categories: green = best, yellow, orange, and red (least...

Ngày tải lên: 21/06/2014, 11:20

12 524 1
Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model

Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model

... Thus, research groups are focusing on using silicon as an anode material instead of carbon based graphite Silicon has a high storage capacity of up to ten times that of graphite, but has a shorter ... Gaines and Cuenca (2000) of Argonne National Lab state that, “The different electrode materials have different current-carrying capacities, and this affects the storage capacities of the resultant ... best practices, a 2.5 Li ion can be intercalated for each hexagonal carbon structure reducing the amount of anode in comparison to cathode and can achieve the theoretical capacity of 750 milliAmphours/gram;...

Ngày tải lên: 10/12/2016, 09:56

107 404 0
Increasing energy efficiency of HVAC systems of buildings using phase change material

Increasing energy efficiency of HVAC systems of buildings using phase change material

... surface heat flux measured on the radiation slab's surfaces and area is the total surface area of the radiation slab The total energy removed from the cases with a radiation slab is the sum of ... is made of weathered stainless steel with external emissivity of 0.85 The walls (hot wall and adiabatic walls) are gray and diffuse and have an absorption coefficient of 0.85 The air has an absorption ... simulate the conventional variable-air-volume (VAV) ventilation system with radiant cooling Case 2's vents were of the same size and position as of Case Case has the addition of the radiation slab,...

Ngày tải lên: 05/09/2013, 15:28

20 405 0
Energy efficiency and cost analysis of canola production in different farm sizes

Energy efficiency and cost analysis of canola production in different farm sizes

... revealed that, total energy input in large farms was significantly higher than that of small and medium farms; also, the yield value of canola in small farms was significantly lower than that of ... regional energy requirements and CO2 emissions in China Energy Policy 2007, 35(3), 1685-1700 [4] Mohammadi A. , Tabatabaeefar A. , Shahin S., Rafiee S., Keyhani A Energy use and economical analysis of ... Ghorbani R., Mondani F., Amirmoradi S., Feizi H., Khorramdel S., Teimouri M., Sanjani S., Anvarkhah S., Aghel H A case study of energy use and economical analysis of irrigated and dryland wheat...

Ngày tải lên: 05/09/2013, 16:30

8 474 0
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... Renewable Energy 2006, 2006 [3] Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called ... generator voltage and the maximum output power can be increased A configuration using a variable series compensation device called a magnetic energy recovery switch (MERS) and a diode bridge has...

Ngày tải lên: 15/10/2013, 16:11

6 802 0
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch

Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch

... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such ... hostname, access, and command mode passwords, as well as the management LAN settings These values are shown in the chart If problems occur while performing this configuration, refer to the Basic ... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright  2003, Cisco Systems, Inc Erasing...

Ngày tải lên: 16/10/2013, 21:15

4 337 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... and biodiversity are most threatened values  Amount of commercial shipping and number of trading partners affecting pathway strength  A limited number of IMP have been identified in APEC Management...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc

Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc

... Inc Erasing and Reloading the Switch For the majority of the labs in CCNA and CCNA it is necessary to start with an unconfigured switch Use of a switch with an existing configuration may produce ... startup configuration from NVRAM #delete nvram This command resets the switch with factory defaults All system parameters will revert to their default factory settings All static and dynamic addresses ... be: Erase of nvram: complete Check that VLAN information was deleted Verify that the VLAN configuration was deleted in Step using the show vlan command If previous VLAN configuration information...

Ngày tải lên: 24/01/2014, 19:20

5 335 0
Tài liệu Energy Efficiency Pays: A Guide for the Small Business Owner doc

Tài liệu Energy Efficiency Pays: A Guide for the Small Business Owner doc

... year After the one-year payback, she puts that extra money toward profits year after year H O T W A T E R ~ APPENDIX A: Energy- Related Agencies and Organizations Air Conditioning Contractors of ... seal that leaks a drop of water every five seconds can save money and hundreds of gallons of water per year And if it is ~ Fix leaking faucets, toilets, a hot water leak, you can showerheads, and ... options Rebuild America Financial Services aids access to capital by pointing partnerships toward programs offered by states, associations, or private financing organizations that may be able to provide...

Ngày tải lên: 18/02/2014, 00:20

48 414 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... the accessible surface area of a monomer contributes to LlPDH dimer formation Whereas LlPDH and OaPDH have a ˚ buried surface area of  5500 A2 , TbPDH has a larger ˚ interface surface area of ... crystallography Acta Crystallogr D Biol Crystallogr 50, 760–763 Navaza J (1994) Amore – an automated package for molecular replacement Acta Crystallogr A 50, 157–163 Jones TA, Zou JY, Cowan SW ... domain II, the helical domain Two large helices a8 and a1 4, antiparallel to each other, form the core of this domain and they are enclosed on either side by a set of four helices (a9 – a1 0 a1 6 a1 7)...

Ngày tải lên: 19/02/2014, 05:20

12 452 0
Do it yourself home energy audit: A step-by-step guide for identifying and improving your home’s energy efficiency pot

Do it yourself home energy audit: A step-by-step guide for identifying and improving your home’s energy efficiency pot

... temperatures using infrared cameras and creates a visual image of heat loss The cameras detect radiation in the infrared range of the electromagnetic spectrum Typically, warmer surfaces appear brighter, ... conservation measures are arranged in the order of their payback to a glassed-in porch It had A Energy Measures that Save a Lot and Have Little or No Cost no wall insulation and floor insulation was ... spray foam to seal leaks Attic/Crawl Space/Basement Use spray foam to seal irregular gaps around pipe and wire penetrations Caulk is effective for small holes In attics, crawlspaces and basements...

Ngày tải lên: 06/03/2014, 23:20

24 454 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL was constructed ... similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, ... 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector pBOS-Myc and pBOSFlag...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

... the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of §2 is translated ... syntactic coverage of English grammars In DARPA, editor Proceedings of the Fourth Darpa Speech and Natural Language Workshop, pages 306-311, Pacific Grove, California, February, Morgan Kaufmann ... coverage of syntactical phenomena as broad as possible in order to allow any parser to participate, whatever the grammatical formalism it uses We have decided immediately upon a twosteps annotation:...

Ngày tải lên: 17/03/2014, 22:20

4 323 0
Secrets of a Successful Attitude potx

Secrets of a Successful Attitude potx

... 20 + years as a sales trainer and manager, specializing in attitude management, here are some definitions of a 'successful attitude' so we all start off on the same page: A successful attitude ... believe that a negative critical mass / breaking point will eventually occur, and probably negatively impact important areas in your life Life is about balance and having a successful attitude means ... training and management career that has spanned over decades Rosey has trained thousands of sales people and has helped them achieve their goals and become more successful and sophisticated sales...

Ngày tải lên: 18/03/2014, 03:20

13 387 0
Gender inequality in health among elderly people in a combined framework of socioeconomic position, family characteristics and social support doc

Gender inequality in health among elderly people in a combined framework of socioeconomic position, family characteristics and social support doc

... Silvia Rueda and Luc a Artazcoz Ferraro, K and Famer, M 1996 Double jeopardy Aging as leveler, or persistant health inequality ? A longitudinal analysis of white and black Americans Journal of ... una escala de apoyo social funcional para su uso en la consulta del medico de familia [Validity of a functional social suport scale for its use on the primary health ´ care] Atencion Primaria, ... mental health and functional limitations (Beckett et al 1996 ; Idler and Benyamini 1997) 628 ´ Silvia Rueda and Luc a Artazcoz Methods Data The data are from the 2006 Encuesta Salud de Catalunya...

Ngày tải lên: 22/03/2014, 14:20

23 420 0
w