8 and osteonectin 9 immunohistochemical staining

... CXCR 4and SDF-1-deficient mice Proc Natl Acad Sci USA 19 98 , 95 :94 48- 94 53 Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR: Function of the chemokine receptor CXCR4 in haematopoiesis and in ... Nature 19 98 , 393 : 595 - 599 Yu X, Huang Y, Collin-Osdoby P, Osdoby P: Stromal cell-derived factor-1 (SDF-1) recruits osteoclast precursors by inducing chemotaxis, matrix metalloproteinase -9 (MMP -9) activity, ... myelopoiesis and organogenesis [8- 11] Both SDF-1-deficient and CXCR4-deficient mice die perinatally and have very few hematopoietic stem cells and progenitors within their bone marrow SDF-1 and CXCR4...

Ngày tải lên: 09/08/2014, 10:23

... 500–1,000 µm2 1,000–5,000 µm2 >5,000 µm2 Control 481 1,002 166 153 22 CXCL12 84 8 1 ,85 4 382 346 90 CXCL12 + AMD3100 5 98 1,143 193 164 AMD3100 580 1,0 08 171 140 In vitro stimulationb aThe bSplenocytes ... 17 18 19 al.: The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 199 6, 382 :83 3 -83 5 Rossi D, Zlotnik A: The biology of chemokines and ... (30%)f 1.4 ± 0.9f 4.7 ± 2.4 2/12 (17%) 9/ 12 (75%) 5.2 ± 0 .9 6.2 ± 0.6 AMD3100 1/7 (14%) 2/7 ( 29% ) 0 .9 ± 0.6f 3.0 ± 1.0 2/7 ( 29% ) 5/7 (71%) 2.4 ± 0 .8 3.4 ± 0.7 AMD3100 2 /8 (25%) 2 /8 (25%)g 0.5g...

Ngày tải lên: 09/08/2014, 07:20

... 20, 687 7– 688 8 FEBS Journal 272 (2005) 193 7– 195 1 ª 2005 FEBS Syndecan-4 is an auxiliary receptor for SDF-1/CXCL12 30 Premack BA & Schall TJ ( 199 6) Chemokine receptors: gateways to inflammation and ... M, Baggiolini M & Moser B ( 199 6) The CXC chemokine SDF-1 is the ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382 , 83 3 83 5 195 0 N Charnaux et al Pablos JL, ... ( 199 9) Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4 Dev Biol 213, 442–456 10 Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML, Lincecum J & Zako M ( 199 9)...

Ngày tải lên: 16/03/2014, 18:20

... Act (P.L 89 –544, as amended by P.L 91 – 5 79, P.L 94 –2 79, and P.L 99 –1 08) , The Guide for Care and Use of Laboratory Animals (NIH Publication No 93 23, 1 98 5 or succeeding revised editions), and the ... 199 3, 90 :83 92 -83 96 Lee SG, Kim S, Robbins PD, Kim BG: Optimization of environmental factors for the production and handling of recombinant retrovirus Appl Microbiol Biotechnol 199 6, 45:477- 483 ... Med 199 7, 186 :2 29- 2 38 Allison J, Stephens LA, Kay TW, Kurts C, Heath WR, Miller JF, Krummel MF: The threshold for autoimmune T cell killing is influenced by B7-1 Eur J Immunol 19 98 , 28: 94 9 -96 0...

Ngày tải lên: 19/06/2014, 08:20

... Act (P.L 89 –544, as amended by P.L 91 – 5 79, P.L 94 –2 79, and P.L 99 –1 08) , The Guide for Care and Use of Laboratory Animals (NIH Publication No 93 23, 1 98 5 or succeeding revised editions), and the ... 199 3, 90 :83 92 -83 96 Lee SG, Kim S, Robbins PD, Kim BG: Optimization of environmental factors for the production and handling of recombinant retrovirus Appl Microbiol Biotechnol 199 6, 45:477- 483 ... Med 199 7, 186 :2 29- 2 38 Allison J, Stephens LA, Kay TW, Kurts C, Heath WR, Miller JF, Krummel MF: The threshold for autoimmune T cell killing is influenced by B7-1 Eur J Immunol 19 98 , 28: 94 9 -96 0...

Ngày tải lên: 20/06/2014, 04:20

... non-integrin (CD2 09) on the cell surface J Biol Chem 20 08, 283 : 388 9- 390 3 Page 12 of 12 45 Dang Y, Davis RW, York IA, Zheng YH: Identification of 81 LGxGxxIxW 89 and 171EDRW174 domains from human immunodeficiency ... http://www.retrovirology.com/content /8/ 1/3 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 type 1: putative role of HIV type tat protein and inflammatory cytokines AIDS Res Hum Retroviruses 2002, 18: 91 7 -93 1 Lawrence ... inhibition is independent of productive infection of progenitor cells in vivo J Virol 199 9, 73 :9 0 89 -90 97 Neal TF, Holland HK, Baum CM, Villinger F, Ansari AA, Saral R, Wingard JR, Fleming WH: CD34+...

Ngày tải lên: 13/08/2014, 01:20

... exons and introns and junction sequences Exon No 10 Position in Scaffold 100 Exon 5’- 3’ end 97 5105 -97 5 391 97 5631 -97 592 7 9 783 09- 9 783 92 99 381 8 -99 399 6 99 4227 -99 4 399 99 51 39- 995 2 48 99 6724 -99 685 8 99 7223 -99 7407 ... GTTTCAGCTGCTGGAGGACGCGTGGATTTGTCAGTGTCAGCTGCGCAGAATGCATCTTCACCTGAGACCTCAAATATGCAGCGCGAGGAAGAGTGGACC 199 AGTCTGACAAGTTTGCTTTAACTGGGAAAACACCTGTTCATTTGGGGGCGCAATGATTTTAACTTTTGTCATCATTTTGTCCTTCACGGATTCGGTGTT 2 98 17 397 50 496 83 595 116 694 1 49 793 182 89 2 215 99 1 2 48 1 090 281 1 1 89 314 1 288 347 ... ligand-binding receptors respectively (Treanor et al 199 6; Baloh et al 199 7; Buj-Bello et al 199 7; Creedon et al 199 7; Jing et al 199 7; Sanicola et al 199 7; Baloh et al 19 98 ; Enokido et al 19 98 ) .,...

Ngày tải lên: 03/10/2015, 20:57

... Before L8 Before L9 Healthy individuals (n = 60) [40] (n = 95 ) [41] Hsp70 antibody levels (μg/ml) 10 .9 ± 0.4 13.2 ± 0 .8 13.3 ± 0.7 6,0 49 ± 1 29 5, 380 ± 145 3, 191 ± 122 2.07 ± 2.74 4 .93 280 ± 58 207 ... (%) ( 69) (57) 1 .8 1.3 Total NK cells (×1 09) NK cells (%) (24) (16) 1.2 8. 3 ( 69) 1 .9 (23) 1.4 4.3 (31) 0 .9 (20) 1.7 5 .8 (34) 1.4 (24) 1.7 6.3 (37) 1.4 (23) 1.3 5.1 ( 39) 1.2 (23) 1.2 6 .9 ( 58) 1.7 ... (%) 68 CD3+ [55 95 ] 51 CD3+CD4+ [35–65] 18 CD3+CD8+ [21–45] 14 CD 19+ [5-20] CD3+CD16+CD56+ 19 CD3-CD16+CD56+ [5-35] 6.3 (22) 14.4 187 5.0 (24) 14.4 135 5.0 (16) 12 .9 1 28 5.2 (14) 12.7 1 49 5.2...

Ngày tải lên: 18/06/2014, 15:20

... CaCl74-36 17.26 6 .83 * LNCaP 29. 09 2. 78 Colo 38 15 .83 1. 49 PC3 15.12 9. 09 Sarcomas (4 /9) Renal (3/6) ** 4 -9 98 58. 31 0 .82 ** 786 -O 75 .91 6.06 Irradiated 52.10 0.44 ** CAKI-1 64 .94 3.70 T cell Depl ... 2.03 22. 28 4.37 0. 28 2 . 89 * Panc 4.14 Panc 9. 6 .94 21 .82 27. 28 2.60 8. 47 ** NCI-H464 63 .96 6.00 Panc-1 7 .82 3. 69 * NCI-H60 47. 79 7.71 Panc 3.27 6. 98 5.44 NCI-HUT 69C -24. 28 16.75 ASPC-1 3. 09 2.36 ... -13. 48 5.01 11.21 Caov-3 -146.53 2. 69 MCF-7 16 .95 0. 39 ** SW 5 79 68. 97 3.41 734B 16.72 2.32 SW 194 9 43 .90 13. 68 T47D 8. 47 1.23 BT-474 0 .83 11.53 Thyroid (1/2) Brain (2 /9) Breast (0 /9) ** NU-04 69. 41...

Ngày tải lên: 18/06/2014, 19:20

... 15 .9 ± 7.6 15 .9 ± 7.1 1.0 CD26+‡ 18. 0 ± 3.7 4.7 ± 4.4 0.031 CD45+¶ 14.1 ± 12.5 11.6 ± 12.0 0 .84 4 CD271+ 18. 4 ± 5.7 16.6 ± 7.6 0. 688 CD 29+ 23.7 ± 8. 7 91 .4 ± 7.1 0.031 CD90+ 35.2 ± 5 .8 88. 1 ± 10 .9 ... 3.5 19. 3 ± 6 .8 0.563 CD34+ 14.1 ± 7 .8 15.1 ± 14 .9 0 .84 4 KDR+ 19. 7 ± 2.5 17.4 ± 8. 2 0.4 38 C-kit+ 3.13 ± 1 .80 2.40 ± 1.24 0.563 Sca-1+ VEGF+ 3.22 ± 1. 49 14.3 ± 5.2 2.72 ± 2.10 14.7 ± 8. 7 0. 688 1.0 ... 20 081 211 08) and performed in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication No Page of 13 85 -23, National Academy Press, Washington, DC, USA, revised 199 6)...

Ngày tải lên: 18/06/2014, 22:20

... cells Circulation 2004, 1 09, 1 292 -12 98 31 Rucker NC, Lumb WV, Scott RJ Combined pharmacologic and surgical treatments for acute spinal cord trauma Am J Vet Res 1 98 1 , 42, 11 38- 1142 32 Safford KM, ... expressed CD44, CD90 and CD105, and were negative for CD14, CD34, CD45 The overwhelming majority (＞ 95 %) of cASC expressed the mesenchymal cell surface markers CD90 and CD105 2 78 Hak-Hyun Ryu et ... injury 275 (#DH29A), CD8 (#CADO46A), CD44 (#BAG40Am), CD45-like (#CADO18A), CD90 (#DH24A), CD14 (#CAM36A), CD3 (#MCA1774; AbD Serotec, USA), CD11c (#MCA1778S; AbD Serotec, USA) and CD34 (#1H6;...

Ngày tải lên: 07/08/2014, 23:22

... Cell 2002, 13:42 79- 4 295 13 Peterkofsky B: Bacterial collagenase Methods Enzymol 1 98 2 , 82 :453-471 14 Salem H, Thiemermann C: Mesenchymal stromal cells: current understanding and clinical status ... considerations Clin Orthop Relat Res 199 9, 367(Suppl):S244-S253 Barry FP: Mesenchymal stem cell therapy in joint disease Novartis Found Symp 2003, 2 49 :86 -96 Zhang HN, Li L, Leng P, Wang YZ, Lv ... 2003, 52: 39- 49 16 Childs JD, Piva SR: Psychometric properties of the functional rating index in patients with low back pain Eur Spine J 2005, 14:10 08- 1012 doi:10.1 186 /1752- 194 7-5- 296 Cite this...

Ngày tải lên: 10/08/2014, 23:21

... CD62L CD80 (B7-1) CD83 CD86 (B7-2) DC-SIGN HLA-ABC HLA-DR Mock Empty LV LV MLV 48. 8 ± 3.2 13.0 ± 0.4 27.3 ± 1.1 8. 6 ± 0.1 462.6 ± 57.5 3.3 ± 0.1 9. 9 ± 0 .9 5 .8 ± 0.3 39. 6 ± 3.5 62.7 ± 4.5 13 .9 ± 1.3 ... 31.5 ± 0 .8 47.2 ± 1.3 13.4 ± 0 .8 27.6 ± 2 .9 8. 9 ± 0.6 376.5 ± 30.1 3.2 ± 0.03 10.6 ± 0.7 5 .8 ± 0.1 39. 6 ± 2.5 55.7 ± 0.4 15 .8 ± 1.0 28. 6 ± 2.2 52.3 ± 2.3 14 .9 ± 0.6 21.5 ± 0.2* 8. 6 ± 0.1 1 79. 5 ± ... 0.1 9. 3 ± 0.2* 6.4 ± 0.01 31.4 ± 0.4* 50.6 ± 1.5* 14.6 ± 0.3 26 .9 ± 0.4 55.3 ± 1.1 15.7 ± 0.1 31.0 ± 0.3 9. 0 ± 0.3 4 98 . 5 ± 6 .9 3.3 ± 0.4 11.3 ± 0.4 6.0 ± 0.3 47.3 ± 1.5 68. 6 ± 4.1 17.2 ± 0 .9 33.2...

Ngày tải lên: 13/08/2014, 13:20

... throughout the mononuclear phagocyte Genome Biology 2007, 8: R 184 R 184 . 28 Genome Biology 2007, 83 84 85 86 87 88 Volume 8, Issue 9, Article R 184 Doss et al system of the mouse Blood 2003, 101:1155-1163 ... D: Cluster analysis and display of genome-wide expression patterns Proc Natl Acad Sci USA 19 98 , 95 :1 486 3-1 486 8 Genome Biology 2007, 8: R 184 http://genomebiology.com/2007 /8/ 9/ R 184 ... Development 2005, 132:1273-1 282 Genome Biology 2007, 8: R 184 http://genomebiology.com/2007 /8/ 9/ R 184 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 Genome Biology 2007, Niwa...

Ngày tải lên: 14/08/2014, 08:20

... pyrophosphatase isoform Q 994 97 1 .85 -2.02 6.33/ 19 , 89 1.05 36 89 1, Q9BWZ9 -1.07 -5 .82 6.52/22 ,84 0.06 26 77 1,2 ,9 P33316 Not in m or mo Not in m or mo 9. 65/26,706. 39 35 93 1,2, MASCOT scores >64 ... 6.51/26,5 38. 30 56 2 09 16 Actin related protein 2/3 complex subunit O15144 -16.74 -20.03 6 .84 /34,333.02 19 91 4,5,6, 1, 17 Carbonic anhydrase II P0 09 18 -15.63 -10 .99 6 .86 / 29, 114 .86 29 88 18 Phosphoglucomutase ... Fructose-1,6-bisphosphatase P 094 67 -14.34 2.62 6.54/36 ,81 8.12 48 205 1, 13 Fascin Q166 58 -8. 78 -7 .87 6 .81 /54,3 98 . 81 23 133 4,5,6 14 Phosphoglycerate mutase I P 186 69 -1.37 -2.21 6.75/ 28, 672.74 47 143 1, 15 Triosephosphate...

Ngày tải lên: 14/08/2014, 18:20

... HSVtk, Fcy and CodA 95 5.3.1 HSVtk/GCV and CD/5-FC mediates bystander effect by different methods 96 5.3.2 Tumor growth rates were reduced but no complete eradication of cancer was observed 98 5.3.3 ... al., 19 98 ; Cheng YC et al., 1 98 3 ) In animal studies, the treated group display significantly extended lifespan and reduction in tumour mass In the HSVtk/GCV system, this cytotoxic bystander effect ... (Rosenberg et al., 1 98 9 ) followed by treatment of children with severe combined immunodeficiency (ADA-SCID) using retrovirus encoding adenosine deaminase gene (Anderson et al., 199 9) Thus far, the...

Ngày tải lên: 09/09/2015, 18:56

... reported by Thomson and coworkers in 19 98 (Bongso et al., 199 4; Thomson et al., 19 98 ) These achievements opened the field, which has seen constant improvements in the derivation and maintenance of ... (Summerford and Samulski, 19 98 ) while αVβ5 integrin and human fibroblast growth factor receptor have been proposed as co-receptors (Qing et al., 199 9; Summerford et al., 199 9) This enables AAV-2 to ... competent E coli and glycerol stocks 49   3 .8   Generation of AAV particles 49   3 .8. 1   Triple transfection using the calcium phosphate method 49   3 .8. 2   Harvesting and freezing...

Ngày tải lên: 26/11/2015, 09:54