8—simplified concept of punching shear see c 2 24 1 1

Ngày tải lên: 21/03/2014, 22:01

... 5¢-TCTTCAGCGGC ATGGGCGACCTCGGCGGCAT-3¢ and 5¢-ATGCCGC CGAGGTCGCCCATGCCGCTGAAGA-3¢ The recombinant protein was purified using a HiTrapÔ chelating column and Resource PHE column (both Amersham Biosciences) ... (angle) (°) Value 1. 0000 20 2. 5 (2. 59 2. 5) 0.096 (0 .19 9) 26 7 8 42 43 425 98.4 (93 .2) 6 .2 (6.0) 17 .9 (8.6) 20 2. 5 (2. 56 2. 5) 0 .23 6 (0 .25 1) 0 .27 6 (0 .29 6) 676 10 7 0. 015 1. 64 a Numbers in parentheses ... of crystal structures Nature 355, 4 72 475 21 Emsley P & Cowtan K (20 04) Coot: model-building tools for molecular graphics Acta Crystallogr D 60, 21 26 21 32 22 Potterton L, McNicholas S, Krissinel...

Ngày tải lên: 23/03/2014, 05:22

... CGCACATGTATCCAGAACT CAAAGAAGATAAGGGCAGGC AGGAGTTCGAGAAGAGCCTG TGATCTGTGTCTGGGCTTTC antisense *nucleotide marker AGAGGTGGACCCATGCTTA CCTAGGCGACTCAGTGAGACT TGCCACTACACCCAGATGAT AGTTGTGACCCTAACATTGCA ... exons 11 , 12 , 13 and 27 variation frequency of alleles exon bp1 codon WG patients controls P value restriction enzymes 11 12 13 1 12 2 G>A 12 9 3T >C2 12 9 6T >C2 3030G>A T 329 T F382F D383D T961T 3 /26 2 7/350 ... citation purposes) Journal of Negative Results in BioMedicine 20 05, 4 :1 10 11 12 13 14 15 16 17 18 19 20 21 http://www.jnrbm.com/content/4 /1/ 1 Esnault VL, Testa A, Audrain M, Roge C, Hamidou M, Barrier...

Ngày tải lên: 11/08/2014, 08:20

... Màu s c Nhiệt độ nóng chảy Nhiệt độ sôi 1/ Lí tính : F 2s22p5 0,064 0 ,13 6 15 9 3.98 Khí L c nhạt 21 9 18 8 Cl 17 3s23p5 0,089 0 ,18 1 24 3 3 ,16 Khí Vàng l c 10 1 –34 Br 35 4s24p5 0 ,11 4 0 ,19 6 1 92 2,96 ... –7,3 –59 I 53 5s25p5 0 ,13 3 0 ,22 0 15 1 2, 66 Rắn Đen tím 11 3 18 5 Flo không tan nư c phân hủy nư c mạnh C c halogen lại tan nư c , tan nhiều dung môi hữu ® Gv Ung Thanh Hải hướng dẫn 2/ Hóa tính : ... hình electron c u tạo phân tử : 1/ C u hình electron : Lớp electron nguyên tử halogen c electron ⇒ c u hình electron lớp ns2 np5 ns2 np5 Ở trạng thái , nguyên tử halogen c electron đ c thân...

Ngày tải lên: 19/05/2015, 07:34

Ngày tải lên: 21/07/2014, 17:20

... Hogg, Richard M II Blake, N F (Norman Francis) PE10 72 .C3 6 19 92 420 '.9 91- 138 81 ISBN 0- 5 21 -26 474-X (v 1) ISBN 0- 5 21 -26 475-8 (v 2) ISBN 5 21 26 475 hardback UP CONTENTS List of maps List of contributors ... Thirteenth Century 12 1 6 -13 07 (2nd edn, Oxford: Clarendon, 19 62) , M McKisack, The Fourteenth Century 13 07 -13 99 (Oxford: Clarendon, 19 59), and E.F.Jacob, The Fifteenth Century 13 99 -14 85 (Oxford: Clarendon, ... syntactic classes Further reading Textual sources 23 39 42 57 67 83 Vll 90 91 103 14 7 15 4 Contents MIDDLE ENGLISH DIALECTOLOGY James Milrqy 3 .1 3 .2 3.3 3.4 4 .1 4 .2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5.1...

Ngày tải lên: 05/08/2014, 14:20

Ngày tải lên: 07/08/2014, 10:20

... which was dedicated to the study of the Streptococci A relative of Pneumococci, Streptococci is a cause of rheumatic fever McCarty’s research established the important role played by the outer cellular ... until 19 71, election American Academy of Microbiology, and inclusion in cations such as Who’s Who in the Frontiers of Scien Outstanding People of the 20 th Century See also Protozoa McCarty, Maclyn ... “Studies of the Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types: Induction of Transformation by a Deoxyribonucleic Acid Fraction Isolated from Pneumococcus Type...

Ngày tải lên: 10/08/2014, 03:20

... against attack ˽ office security the act of protecting an office against theft the fact of being kept secret ˽ security in this office is nil nothing can be kept secret in this office a guarantee ... original cost Also called current cost accounting Compare historical cost accounting replacement cost depreciation /r plesmənt kɒst d pri ʃi eʃ(ə)n/ noun depreciation based on the actual cost of ... financing of development self-insurance 320 costs, the purchase of capital assets, etc by a company from its own resources í adjective ˽ the company is completely self-financing the company finances...

Ngày tải lên: 05/08/2014, 13:20

... < 10 0 No. /10 0ml No. /10 0ml No. /10 0ml No. /10 0ml 10 0-400 10 -10 10 3 -10 5 10 -1- 100 10 -1- 1 01 10 -10 10 4 -10 6 10 -1- 1 01 10 -1- 1 02 > 400 10 7 -10 10 10 5 -10 8 10 -1- 1 02 10 -1- 103 a: From Tchobanoglous et al., 20 03 ... 82- 96 ND ND 55- 82 ND 52- 72 82- 96 41- 68 41- 55 60 -15 0 TKN g/capita.d 8 -14 14 -19 8 -14 11 -16 ND ND 8 -14 1- 3 4-7 11 -16 8 -14 8 -14 9 -22 NH3-N g/capita.d ND ND ND ND 8 -10 ND ND ND 3-5 ND 9 -11 ND 5- 12 ... no of persons Flowrate, L/capita.d Range 28 5-490 22 5-385 19 4-335 15 5 -26 8 15 0 -26 0 14 7 -25 3 14 0 -24 4 13 5 -23 3 a: From Tchobanoglous et al., 20 03 19 Typical 365 28 8 25 0 20 0 19 3 18 9 1 82 17 4 Table 1. 5...

Ngày tải lên: 09/01/2015, 08:54

... 32- 68 68- 82 27-50 55-68 50- 12 0 TSS g/capita.d 55-68 82- 96 41- 68 82- 96 ND ND 55- 82 ND 52- 72 82- 96 41- 68 41- 55 60 -15 0 TKN g/capita.d 8 -14 14 -19 8 -14 11 -16 ND ND 8 -14 1- 3 4-7 11 -16 8 -14 8 -14 9 -22 ... mg/L < 10 0 10 0-400 > 400 No. /10 0ml No. /10 0ml No. /10 0ml No. /10 0ml 10 -10 10 -10 -1 10 -10 -1 10 -10 10 -10 10 -10 -1 10 -10 -1 10 -10 High strength 12 3 0 860 520 340 400 85 315 20 a: From Tchobanoglous ... no of persons Flowrate, L/capita.d Range 28 5-490 22 5-385 19 4-335 15 5 -26 8 15 0 -26 0 14 7 -25 3 14 0 -24 4 13 5 -23 3 a: From Tchobanoglous et al., 20 03 19 Typical 365 28 8 25 0 20 0 19 3 18 9 1 82 17 4 Table 1. 5...

Ngày tải lên: 20/06/2016, 10:25

... ………………… an appointment a to cancel b cancel c canceling d canceled a 10 A computer is usually chosen because of its simplicity of operation and ease of maintenance its capacity to store information ... known as the ecliptic b known as the ecliptic c it is known to be ecliptic d knowing as the ecliptic a 15 7 This table is already …………… a occupy b occupied c occupation d occupational b 15 8 A dolphin ... years a also b as well c so well d so a 1 92 It’s an …………… advice service a occupied (v) b occupied (adj) c occupation d occupational d 19 3 Some important characteristics of the baroque style...

Ngày tải lên: 14/08/2013, 23:26

... Prepositions of place Look AT THE picture and write sentences to describe the kitchen The plate / the table is on the table The fruit / the the bowl is in bowl The rice cooker isthe bowlthe / next to of ... Prepositions of place Noughts and crosses o oo xxx o oo xxx o oo xxx Revision Prepositions of place Look at the picture and fill in the suitable prepositions There is a refrigerator on the right of the ... cupboard Revision Prepositions of place Look at the picture, use the preposition to describe the room Revision Prepositions of place Homework Use the prepositions to describe your living-room ...

Ngày tải lên: 06/09/2013, 23:10

... at the map please!  While – writing Activity 1: Study words and phrases that are used to give directions with the ma below Come out of Turn Take the second turning onTurnleft right the left ... phrases are used to give directions        Come out of Turn right/left Keep walking /go straight Go over (a bridge) Walk past (a medical center) Take the first /second turning on the left/right ... soon Best wishes, LE • Car park so hp A B I i ou eni ou eni ou enir Souven sh sh sh shop Shoe shop A F H A Bo o sh k op J G C Medical center E D Roston Railway station Now check your mistake with...

Ngày tải lên: 11/10/2013, 14:11

... then click Computer Management In the left pane, right-click Computer Management (Local), and then click Connect to another computer… Select your partner’s computer Click OK to close the Select Computer ... Tools, and then click Computer Management Right-click Computer Management (Local), and then click Connect to another computer… Select your partner’s computer, and then click OK !!To change permissions ... the resources are located To connect to a computer at a remote location: In the Computer Management window, right-click Computer Management (Local) and then click Connect to another computer In...

Ngày tải lên: 18/10/2013, 18:15

... anywhere? case of: We bought a case of wine VOCABULARY: FOOD PREPARATION AND COOKING 21 recipe /’resCpI/ noun [count] a set of instructions for cooking or preparing a particular food: c ng th c làm ... packet: thùng hàng package of: an 8oz package of cream cheese 20 case /keIs/ noun [count] a container or cover for keeping or protecting something: hộp, hòm, thùng Have you seen my glasses’ case ... flowers adornment /C dc:nmCnt/ noun [count or uncount]: vật trang trí, trang trí 69 extravagance /Ik’strAvCgCnts/ noun [uncount] the practice of spending a lot of money, especially more than you...

Ngày tải lên: 20/10/2013, 01:15

... 1, 2 3, 1 8 1 8 24 48 24 48 RJ21x RJ21x RJ21x RJ21x patch patch patch patch panel panel panel, T568B panel, T568B Rack Units Catalog Number 2 ADCPP24 510 0TEL ADCPP48 510 0TEL ADCPP245800BTEL ADCPP485800BTEL ... 1RU x 19 " or 23 " MPP-GDXBA2 24 RJ4 8C shielded 50-pin shielded 1RU x 19 " MPP-CXFBA1-S 24 RJ4 8C 50-pin 1RU x 19 " MPP-CXFBA1 32 RJ4 8C 50-pin 1RU x 19 " MPP-CXZXBT2A www.adc.com Wiring • +1- 9 52- 938-8080 ... 5e 5e 5e 1 1 RJ45 coupler panel Catalog Number ADCPP24606 ADCPP48606 ADCPP24RJ6-S ADCPP24RJ5E-S ADCPP24505 ADCPP48505 ADCPP16KSRJRJ ADCPP32KSRJRJ RJ45 coupler panel (front view) 1 020 94AE TrueNet®...

Ngày tải lên: 24/01/2014, 11:20

... A Table 1- 1 Comparison of the S7 -20 0 CPU Models Feature CPU 22 1 CPU 22 2 CPU 22 4 CPU 22 6 CPU 22 6XM Physical size (mm) 90 x 80 x 62 90 x 80 x 62 12 0 .5 x 80 x 62 19 0 x 80 x 62 19 0 x 80 x 62 Program ... Counter Bits C0 C1 C2 C3 (LSB) Accesses the current value Figure 4-6 26 Accessing the Counter Bit or the Current Value of a Counter C3 C0 C1 C2 C3 Accesses the counter bit PLC Concepts Chapter High-Speed ... project is associated with a CPU type (CPU 22 1, CPU 22 2, CPU 22 4, CPU 22 6, or CPU 22 6XM) If the project type does not match the CPU to which you are connected, STEP Micro/WIN indicates a mismatch...

Ngày tải lên: 25/01/2014, 21:20