8 formation of a template for ecg analysis signal averaging
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
Ngày tải lên :
06/03/2014, 22:21
... demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure of ... Karplus PA (1997) Improved R-factors for diffraction data analysis in macromolecular crystallography Nat Struct Biol 4, 269–275 Richter Dahlfors AA & Kurland CG (1990) Novel mutants of elongation ... conformation (C), and EF-G stability (D) Several mutations seem to affect more than one of these parameters; for example, EF-G conformation and stability are intimately linked to FA binding as...
- 15
- 474
- 0
Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc
Ngày tải lên :
07/03/2014, 22:20
... 17(1):43–75 Masaki Murata, Kiyotaka Uchimoto, Qing Ma, Toshiyuki Kanamaru, and Hitoshi Isahara 2005 Analysis of machine translation systems’ errors in tense, aspect, and modality In Proceedings of PACLIC ... identify statistical machine translation errors In Proceedings of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages ... Philadelphia, Pennsylvania, USA Maja Popovi´ , Adri` de Gisper, Deepa Gupta, Patrik c a Lambert, Hermann Ney, Jos´ Mari˜ o, and Rafael e n Banchs 2006 Morpho-syntactic information for automatic...
- 6
- 479
- 0
Báo cáo khoa học: "A System for Semantic Analysis of Chemical Compound Names" pdf
Ngày tải lên :
08/03/2014, 01:20
... chemical compound names, name normalization is a possible approach Rules can be set up to transform syntactic as well as morphological variations of names into a normalized name form Basic transformations ... constraints over a collection of variables Each of the variables has a domain, which is the set of possible values the variable can take For the reasons named above, we are working with graph variables ... CompLife, pages 107–118 Kirill Degtyarenko, Paula de Matos, Marcus Ennis, Janna Hastings, Martin Zbinden, Alan McNaught, Rafael Alc´ ntara, Michael Darsow, Micka¨ l Guedj, a e and Michael Ashburner...
- 9
- 479
- 0
Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria
Ngày tải lên :
05/05/2014, 08:44
... accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during growth is necessary According ... and derivatisation of the lactic acid present in the filtrate with methanol, lactic acid was measured through gas chromatographic analysis of the methyl ester (separation with a Delsi GC on a ... carbowax 20 M on chromosorb W-AW 80/ 100, detection with flame ionisation, peak integrator of Trivector) Analysis and adaptation of the model of Nicolaı ¨ et al (1993) Nicolaı et al (1993) have...
- 12
- 625
- 0
Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc
Ngày tải lên :
22/06/2014, 23:20
... EURASIP Journal on Applied Signal Processing disadvantages of the signal- independent form in the analysis of multicomponent signals having different widths of the auto-terms In addition, it may ... Imag) value (in each further step) SignLoad 1-bit signal which enables sampling of the analyzed analog signal f (t), but only after execution of the desired TFD of the analyzed signal samples ... practice, reference value is selected based on a simple analysis of the analyzed signal and the implementation system [10, 17] It is defined as a few percent of the SPEC’s maximal value at a considered...
- 18
- 385
- 0
Báo cáo y học: "MetaReg: a platform for modeling, analysis and visualization of biological systems using large-scale experimental data" pptx
Ngày tải lên :
14/08/2014, 08:20
... variables For example, gene expression data are automatically matched to the corresponding mRNA variables, and protein measurements are matched to the corresponding protein variables As part of ... provided as is and no guarantee or warranty is given that the information is fit for any particular purpose The user thereof uses the information at its sole risk and liability The graphical capabilities ... the paper RS conceived and supervised the study and co-wrote the paper Additional data files The following additional data are available with the online version of this paper Additional data file...
- 11
- 380
- 0
A framework for modeling, analysis and optimization of robust header compression
Ngày tải lên :
16/09/2015, 12:35
... the quantification and analysis of TCP/IP inter-flow field behavior based on a database of million packet headers captured from real traffic The details on the behaviour of all TCP/IP header fields ... work and discussions with Mr Sukanta Kumar Hazra and Mr Wang Haiguang Many others have contributed to making the author’s candidature at the Institute for Infocomm Research a satisfying and enlightening ... applicable to Channel B, we know from Eq (3.4) as nA → ∞, jA → ∞ that P ( LA = l A ) = where A l A( n A − l ) n A →∞ ( ), P A0 = 1, A 1 = 0, , A lA = 0, A lA −1 = P ( A0 = 1) (3.8) We assume that...
- 89
- 448
- 0
A framework for the analysis and assessment of accountability arrangements in the public domain
Ngày tải lên :
11/12/2016, 11:11
... imposition of formal or informal sanctions on the actor in case of malperformance or, for that matter, of rewards in case of adequate performance This is what I would call narrow accountability.4 ... public authority, are subject to public accountability at all This is basically a mapping exercise – for example: what are the accountabilities, formal and informal, of a particular European agency? ... great variety of administrative agents, but gradually they have acquired a legitimacy of their own and they can act as independent accountability forums Most forms of professional accountability...
- 37
- 535
- 0
Module 8: Routing as a Solution for Private Network Connectivity
Ngày tải lên :
18/10/2013, 18:15
... examples of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... if the area can be summarized with a single route Ensure that multiple ABRs for the same area are summarizing the same routes Ensure that all inter-area traffic crosses the backbone area Keep ... One-Way Authentication In one-way authentication, the demand-dial router initiates the connection and authenticates by using a predefined account and password The disadvantage of one-way authentication...
- 50
- 371
- 0
Tài liệu Module 8: Concepts of A Network Load Balancing Cluster ppt
Ngày tải lên :
18/01/2014, 05:20
... high availability features of a Network Load Balancing cluster C C B B A A Load balance 1/3 each Server B Fails Convergence Load Balance ½ each Lead-in Network Load Balancing manages TCP/IP traffic ... Network Load Balancing manages TCP/IP traffic to maintain high availability and dynamic load balancing for IP-based services When a host fails or goes offline, Network Load Balancing automatically ... clarification of two types of client states, application data state and session state: Application data state It is important to consider whether the server application makes changes to a data...
- 44
- 541
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
Ngày tải lên :
18/02/2014, 08:20
... [49,50] Standard procedures were used for the preparation and ligation of DNA fragments, for the transformation of Escherichia coli and for the isolation of plasmid DNA from bacterial cells [51] ... This strain, as expected, was respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found ... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
Ngày tải lên :
19/02/2014, 17:20
... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... alkaline phosphatase gene from hypophosphatasia patients J Bone Miner Res 13, 1827–1834 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada ... (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers Not only the aggregate...
- 14
- 445
- 0
DEAP: A Database for Emotion Analysis using Physiological Signals ppt
Ngày tải lên :
07/03/2014, 14:20
... we have presented a database for the analysis of spontaneous emotions The database contains physiological signals of 32 participants (and frontal face video of 22 participants), where each participant ... Features extracted from EEG and physiological signals Signal Extracted features average skin resistance, average of derivative, average of derivative for negative values only (average decrease ... [0.1-0.2]Hz) EMG and eye blinking rate, energy of the signal, mean and variEOG ance of the signal EEG theta, slow alpha, alpha, beta, and gamma Spectral power for each electrode The spectral power asymmetry...
- 15
- 1K
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
Ngày tải lên :
07/03/2014, 16:20
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...
- 14
- 473
- 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
Ngày tải lên :
23/03/2014, 10:20
... m)1Æcm)1) after dilution in water AMA was from Sigma Aldrich (Milan, Italy) All other reagents, purchased from different companies, were of analytical grade Rabbit serum raised against HNE–protein adducts ... progressive formation of HNE–OBP adducts after incubation with increasing amounts of the aldehyde, and a spectrophotometric titration that allowed quantitative determination of the HNE reactive amino acids ... considered as an extracellular counterpart of the chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that 5138 are abundantly expressed in nasal mucosa [22] Furthermore,...
- 12
- 386
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
Ngày tải lên :
23/03/2014, 13:20
... Fig 3) (B) Analysis of a standard mixture containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc (C) Analysis of peak (Fig 3A) (D) Analysis of peak (Fig 3A) different chromatographic mobility on ... strain CP N-terminal peptide Monosaccharides were analyzed as AMC derivatives (A) Analysis of a blank sample (eluate fraction between peaks in chromatographic profile shown in Fig 3) (B) Analysis ... demonstrated by fiber X-ray diffraction analysis [33], and, as shown by Falconi et al [31], water hydration sites are mainly located around protein cavities and clefts Raman optical activity spectra also...
- 10
- 398
- 0
Báo cáo khoa học: "Demonstration of a prototype for a Conversational Companion for reminiscing about images" doc
Ngày tải lên :
23/03/2014, 16:20
... interfaces for the Dialogue Action Forms (DAF) to use It has an easyto-use high-level interface for general DAF designers to code associated tests and actions as well as a low level interface for advanced ... ability of the system to handle more than one kind of application at a time, and news has, of course, an unconstrained vocabulary The following is a fairly typical example of its current capacity, ... Morgan Kaufmann, CA David Traum, Susan Robinson, and Jens Stephan 2004 Evaluation of multi-party virtual reality dialogue interaction, In: Proceedings of Fourth International Conference on Language...
- 6
- 271
- 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc
Ngày tải lên :
29/03/2014, 21:20
... (pNPa GlcNAc), a- d-xylopyranose (pNPaXyl), a- d-mannopyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNPaAraf) and a- l-rhamnopyranose (pNPaRha) (less than 10 lm pNP liberated ... AglC was tested towards mm pNPaGal, pNPaGalNAc, pNPaAra, pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha, pNPaXyl, and pNPbGal, and 0.4% galactomannans in 40 mm Na acetate pH 5.0, 0.02% BSA, for ... mixture of a- and b-galactose from Oryza sativa a- galactosidase [28], N-acetyl -a- galactosamine from Gallus gallus a- N-acetylgalactosaminidase [29] and melibiose from human a- galactosidase [27]...
- 14
- 579
- 0
Báo cáo khoa học: Solubility-dependent structural formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment pot
Ngày tải lên :
29/03/2014, 23:20
... Val, Ala, Phe, Cys and Met, which have notably larger hydration potentials (greater than $ )2 kcalÆmol)1) than those of any other amino acids (less than $ )5 kcalÆmol)1), as candidates for amino ... 2009 FEBS KKFACPECPK10 YAFACPACPK YAFACPACPK YAFACPACPK YAFACPACPK RFMRSDHLSK20 RFMRSDALSK RFMRSDALSK RFMRSDALSK RFMRSDALSK HIKTHQNKK HIKTA HIKTAFIVVA30 HIKTAYIVVA HIKTAYISVA LG LG LG 2337 Solubility-dependent ... imply a significant probability that a random sequence of amino acids will encode a globular conformation, in general, and a particular native structure, in specific [12] The globular conformation...
- 12
- 338
- 0