8  open a file with its default application

... design has the benefit of separating data processing from acquisition and application concerns This may lead to greater encapsulation of data and maintainability This design has the drawback of ... referential montages is that all electrode potentials are calculated with respect to a reference electrode placed in an electrically quiet area The main advantage of such a recording method is that ... a fairly uniform appearance due to symmetrical rising and falling phases One example of a regular waveform would be a sinusoidal wave Other waveforms may be irregular, having uneven shapes and...

Ngày tải lên: 11/09/2015, 21:51

... describes diagrams by keywords and parameter-value pairs Parameter-value pairs denote the contents of diagrams such as block sample times by associating particular values with relevant parameters ... example, two state variables Gas and Flame are introduced in a gas burner system to characterize the flowing and burning of gas Specifically, Gas(t) = means that gas is flowing and Flame(t) = means ... the declarations are of different types That is to say, functions can have the same name as long as they have different argument types, and a function and an axiom can have the same time although...

Ngày tải lên: 14/09/2015, 08:23

... trade imbalances The changing exchange rate eventually restores a steady state As Chart shows, and as is clearly implied by equations 25) and 26), the share of $ bills in # portfolios immediately ... that Mundell (1961) himself was aware that the automaticity of the rules of the game relied on a particular behaviour of the central bank Indeed he lamented over the fact that modern central banks ... rises and that of # bills in # portfolios falls by an equivalent amount so long as both shares are measured in # currency However this conceals the fact that because the exchange rate has changed...

Ngày tải lên: 06/03/2014, 15:21

... chirata joins the growing list of secondary plant metabolites that are derived from an early shikimate derivative as opposed to a pathway via phenylalanine and cinnamate A hypothetical mechanism ... phosphoenolpyruvate unit by decarboxylation of Cambridge Isotope Laboratories (Andover, MA, USA) [U-13C9]Cinnamic acid was prepared by treatment of 13 L-[U- C9]phenylalanine with phenylalanine ammonia-lyase ... intermediary metabolites such as carbohydrate phosphates, pyruvate, and acetyl-CoA via the major glucose utilization pathways (glycolysis and pentose phosphate cycle) Simultaneously, intermediary metabolites...

Ngày tải lên: 08/03/2014, 02:21

... structures with various C-tail conformations (Fig 7) Such a mechanism may also rationalize the broad-range potency of this toxin on insect as well as mammalian peripheral and brain Navs [5,16,18] A similar ... to a Histag-Apamin-linker (HA-Lqh3) Two oligonucleotide primers were used to construct HA-Lqh3 using the pET-14b vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, ... neuronal preparations [7,8] Accordingly, scorpion a- toxins were divided into three pharmacological groups (Fig 1): (a) Classical anti-mammalian toxins that bind with high afnity to rat brain synaptosomes...

Ngày tải lên: 23/03/2014, 09:20

... Analysis Recent Advances in Natural Language Processing:144–149 Manabu Okumura and Eiji Nanba 2005 Science of knowledge: Automatic Text Summarization.(in Japanese) ohmsha Manabu Okumura and Hajime ... summarization Journal of Artificial Intelligence Research (JAIR Harendra Bhandari, Masashi Shimbo, Takahiko Ito, and Yuji Matsumoto 2008 Generic Text Summarization Using Probabilistic Latent Semantic ... Information Retrieval:50–57 Tsutomu Hirao, Takahiro Fukusima, Manabu Okumura, Chikashi Nobata, and Hidetsugu Nanba 2004 Corpus and evaluation measures for multiple document summarization with...

Ngày tải lên: 23/03/2014, 16:20

... individual units in the ASU (Fig 1B,D) Each CTPR390 unit is composed of three TPR repeats (AB-helix pair) and an additional C-terminal capping helix (Acap) The only way for molecules AB–AB–AB–Acap ... efficient analytical calculation of the accessible surface area and their gradient for macromolecules J Comput Chem 19, 319–333 12 Kajander T, Cortajarena AL & Regan L (2006) Consensus design as a tool ... spokes radiating towards the ligand atoms that they contact The contacted atoms are shown with spokes radiating back (C) Schematic representation of TPR 2A Hsp90 peptide interactions generated as in...

Ngày tải lên: 29/03/2014, 08:20

... extract signals in a specific order [19], or extract special signals, such as fetal ECG [13] and fMRI data [14], and they not always work well when dealing with an AA signal AA sources have a main ... signal In the paper, we validate this algorithm and illustrate how it can be used to estimate the AR parameters of the AA wave signal We also summarize techniques that can be used to extract AA ... ROI, and its SC is more than 40% Comparisons are done among ALG1, ALG2, and Ours2 algorithms, and the AR parameters used in ALG1 would be obtained from the extracted AA by ALG2 The applications...

Ngày tải lên: 21/06/2014, 22:20

... tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni eht ... .)daehworra( ytivac laenotirep eht dna )worra( elcirtnev laretal tfel eht otni decalp saw tnuhs PV ehT edimalozateca ,enosahtemaxed htiw detaert saw god ehT ]01[ ellenatnof tnetsisrep a ro daeh ... tcudeuqa cilahpecnesem deworran a evlovni sulahpecordyh latinegnoc fo sesac rehtO etar etauqeda na ta FSC brosbaer ot illiv dionhcara eht fo eruliaf ot eud yltnerappa giF si sulahpecordyh )latinegnoc(...

Ngày tải lên: 07/08/2014, 18:21

... generalized tenderness and a high riding patella with a palpable gap beneath it consistent with a patellar tendon rupture X-rays revealed marked patella alta with some mild HO in his distal quadriceps ... his patella A repair was accomplished by weaving sutures through the patellar tendon and drill holes in his patella Postoperatively, our patient was placed in a long leg cast Our patient was not ... Cite this article as: Chen and Chmell: Heterotopic ossification after patellar tendon repair in a man with trisomy mosaicism: a case report and literature review Journal of Medical Case Reports...

Ngày tải lên: 10/08/2014, 23:20

... malignancy after biopsy (Figure 1A, C) He also had a left vesicoureteral reflux grade III, with normal renal function His cardiac, audition and fundus of the eye examinations were normal, as was ... parts by the DFG (LI 820/22-1) and DAAD (D07/00070) Author details Pediatr a y jefe de sección de genética pediatrica del HUCA, Oviedo, Spain AbaCid-Genética Hospital de Madrid Norte Sanchinarro, ... delay and a bilateral convergent strabismus; also he started walking when he was 22 months old At the age of 10 years, his testes were surgically descended And at the age of 13 years the strabismus...

Ngày tải lên: 11/08/2014, 03:21

... (normal range: 14-50 U/l), alanine aminotransferase 69 U/l (normal range: 12-50 U/l), alkaline phosphatase 350 U/L (normal range: 30-125 U/l), gamma-glutamyltransferase 271 umol/l (normal range: ... Soulier J, Cacoub P, Welker Y, Cadranel J, Cazals-Hatem D, Autran B, Clauvel JP, Raphael M: Multicentric Castleman's disease in HIV infection: a clinical and pathological study of 20 patients AIDS 1996, ... generalized lymphadenopathy and hepatosplenomegaly The pathological examination of lymph nodes reveals angiofollicular hyperplasia, atrophic germinal centers surrounded by concentric layers of small...

Ngày tải lên: 11/08/2014, 17:21

... Navarrete G: Navarrete Laser supraglottoplasty for laryngomalacia: are specific anatomical defects more influential than associated anomalies on outcome? Inter J of Ped Oto 2001, 57:235-244 Catalfumo ... native cartilage tissue relies on rapid photothermal heating to accelerate stress relaxation of cartilage grafts [1] Laser mediated cartilage reshaping (thermochondroplasty) is a non-ablative, ... G, Bizakis J, Christodoulou P, Velegrakis G, Segas J, Bagratashvili V: Laser shaping of composite cartilage grafts Am J Otolaryngol 1993, 14:410-2 Velegrakis GA, Papadakis CE, Nikolidakis AA, Prokopakis...

Ngày tải lên: 11/08/2014, 20:20

... fluorescence data files from each plate were analyzed using automated software (SDS 2.1) Detailed information concerning the primers is presented in additional file 1, table S1 Bronchoalveolar lavage and ... associations was calculated with false-positive rate of 5% and four given MAFs and sample sizes and Page of assuming a relative risk of 1.5, using PGA (Power for Genetic Association Analyses) software ... chi-square (MHC) tests were used to test for trend in the categorical analysis The data were managed and analyzed using SAS version 9.1 (SAS Inc., Cary, NC, USA) Statistical power of single associations...

Ngày tải lên: 12/08/2014, 13:22

... corpora have a digital format and are available on the internet Detailed information about the translations was not available In the study, both quantitative and qualitative methods were adopted ... written language, it is important to maintain enough information, appropriate grammatical structures as well as rational organization of sentences Grammatical metaphor: Written language presents rather ... semantically related in some way Halliday and Hasan (1976) classify lexical cohesion into two main categories: reiteration and collocation Reiteration Reiteration, according to Halliday and Hasan...

Ngày tải lên: 28/02/2015, 11:54

... surface-based analysis, in particular, surface-based registration for optimizing the alignment of anatomical and functional data across individuals, has received great attention in both anatomical and ... the template shape Itemp and target shape Itarg are calculated via a variational formulation of the “inexact matching problem” Associate for each pair (Itemp , Itarg ), a norm-squared cost is E(ϕ1 ... Tables 4.1 The average overlap ratios (mean(standard deviation, SD)) are listed to quantify intra-reliability of the manual sulcal delineation (the second column) and sulcal alignment accuracy...

Ngày tải lên: 09/09/2015, 18:53

... inter-batch standard deviation 153  xvi List of symbols LIST OF SYMBOLS A constant of Heckel plot AAI air accelerator insert ASA acetylsalicylic acid AUCheat area under the temperature against ... require automated sampling and sample transfer to an automated analyzer Both at-line and off-line techniques involve manual sampling but in the former, the samples are transported locally to an analyzer ... Photographs of PG features: (a) air distribution plate showing central orifice, (b) air distribution plate showing graduated open area, (c) AAIs of various opening diameters and (d) air swirl accelerator...

Ngày tải lên: 11/09/2015, 09:15

... _ (a) (b) Fig 3.5 (a) The steerer table and (b) the 90° analyzing magnet on the analyzer table Source: [33] On both steerer and analyzer tables, a beam profile monitor (BPM) and a faraday cup ... the AC cycles Potential differences across each charged capacitor along the stack eventually add up to the terminal voltage A generating voltmeter (GVM) measures the potential of the terminal ... High voltage insulation and Electron suppression The accelerator tank is filled with a heavy non-toxic insulating gas SF6 at a pressure of bar SF6 has a dielectric strength approximately 2.5...

Ngày tải lên: 14/09/2015, 08:44

... orientation within the main chamber It allows for translation in the x, y θ Motor and z axes, as well as rotation about the θ and φ axes (Fig 3.9) The translation resolution is 0.01 mm with a repeatability ... contained within the load lock chamber (a) (b) Goniometer Gate Valve V1 V1 Main Chamber Load lock chamber (c) Main chamber Main viewport Fig 3.7 (a) Main chamber, goniometer and load lock (b) Load lock ... pump and valve network During sample change, programmed sequences can be initiated from the graphical user interface on the control cabinet which automatically activates the appropriate valves...

Ngày tải lên: 14/09/2015, 08:44

... Mathematica, and ε was calculated using the measured value of B A graph of surface edge position vs ε was plotted and compared to the numerical and analytical calculated data using Mathematica ... Numerical and analytical (Direct and Matrix) calculations Numerical calculations show slightly better agreement to the experimental than the analytical calculations, due to more accurate modeling ... Beam entry parameters The backscattered ion beam entering the magnet is calculated in the same manner in both Direct and Matrix calculations The ion beam was assumed to have incident on a target...

Ngày tải lên: 14/09/2015, 08:44