7—measurement of flange warpage and tilt see c 5 23 8

... hr) 35% kPa 38% kPa 38% 55 kPa 38% –90 kPa 84 .26a 85 . 35b 83 .4 3c 82 .49d 35% kPa 38% kPa 38% 55 kPa 38% –90 kPa –0.46e –0.62f –0.47g –0.35h 35% kPa 38% kPa 38% 55 kPa 38% –90 kPa 25. 30i 25. 41i ... Instrument Translucency (%) Rank Sum Strands 9.1 23 .5 33.3 42.7 53 .0 60.7 Rank Sum Disks 32 65 90 130 160 187 Instrument 32 68 94 129 1 58 191 Rank Sum Strands 40.0 45. 2 51 .0 55 .6 60 .8 65. 0 Rank Sum ... effects of increased thickness due to cooking Translucency was calculated as translucency %/mm, and all measurements were adjusted to a standard cooked noodle thickness of mm Experiment The effect...

Ngày tải lên: 16/12/2012, 15:25

... in which a lock-up provision is determined to be a characteristic of the security and not entity-specific based on the specific terms and nature of the restriction In that case, the restriction ... Application of IFRS Accounting under IFRS Impact of IFRS For access to an extensive range of accounting, auditing and financial reporting guidance and literature, visit KPMG’s Accounting Research Online ... characteristics A valuation technique has the following principal characteristics It: •• is commonly used by market participants; •• is consistent with accepted economic methodologies and techniques;...

Ngày tải lên: 23/03/2014, 11:20

... http://www.jneuroengrehab.com/content/3/1/21 full body analyses of kinematics and kinetics using the Selspot/TRACK data acquisition system during standing and locomotion activities, with precision and accuracy of < ... monitors and electronic load transducers are problematic in their technical and practical limitations, and no reports exist in the literature regarding their accuracy in measuring human physical activity[ 18] ... Rev Food Sci Nutr 1996, 36:3 85 - 396 Melanson ELJ, Freedson PS: Validity of the Computer Science and Applications, Inc (CSA) activity monitor Med Sci Sports Exerc 19 95, 27:934-940 Nichols JF, Patterson...

Ngày tải lên: 19/06/2014, 10:20

... -6 08. 01 - 51 9. 75 MPJ3 45 1274 .86 ( 323. 61) 1294.47 ( 254 .97) 0. 75 (0 .54 - 0 .87 ) 9.2 54 9.17 -52 9 .55 - 58 8. 39 MPJ2 1794.61 ( 382 . 45) 182 4.03 (274 . 58 ) 0. 78 (0 .59 - 0 .89 ) 7.3 52 9 .55 - 480 .52 - 57 8 .59 MPJ1 ... - 0 .87 ) 6 .8 480 .52 - 451 .10 - 52 9 .55 MPJ1 1627.90 (441.29) 17 35. 77 (441.29) 0 .87 (0 .57 - 0 .88 ) 12 .5 5 78 .59 - 686 .46 - 480 .52 Hallux 183 3 .84 (421. 68) 17 75. 00 (411 .87 ) 0. 78 (0 .59 - 0 .89 ) 10 .8 53 9.36 ... 274 . 58 Midfoot 50 0.13 (127. 48) 52 9 .55 (147.09) 0.44 (0.10 - 0.69) 20.0 284 .39 -313 .81 - 254 .97 MPJ3 45 1 255 . 25 (196.13) 12 65. 05 (196.13) 0. 75 (0 .55 - 0 .88 ) 7 .8 274 . 58 - 284 .39 - 264.77 MPJ2 1 755 .39...

Ngày tải lên: 10/08/2014, 21:24

... Switzerland BNP, France HSBC Holdings, U.K J.P Morgan & Chase Company, U.S Bayerische Hypo-Und Vereinsbanken, Germany 1, 281 , 389 1, 057 , 657 85 4 ,749 8 15, 126 8 05, 433 753 ,83 3 734 ,83 3 694 ,59 0 712 ,50 8 6 38 ,54 4 ... 1 75 150 1 25 100 75 50 25 19 35 1940 19 45 1 950 1 955 1960 19 65 1970 19 75 1 980 19 85 1990 19 95 2000 20 05 F I G U R E Bank Failures in the United States, 1934–2002 Source: www2.fdic.gov/qbp/2002sep/cbl.html ... Providence, R.I ABN Amro, North America, Chicago 10 US Bancorp, Minneapolis, Minnesota Total Share of All Commercial Bank Assets (%) 1, 057 , 657 712 ,50 8 15. 19 10 .23 619,921 319, 85 3 8. 90 4 .59 311 ,50 9...

Ngày tải lên: 06/07/2014, 13:20

... Apr 56 50 57 00 1.20 0. 75 1.37 1.04 1.44 1. 15 0.06 0.11 0.24 0.40 0.63 0 .83 57 50 58 00 58 50 59 00 0.41 0.20 0.09 0.02 0. 75 0 .52 0.34 0.22 0.90 0.69 0 .52 0.39 0.27 0 .56 0. 95 1. 38 0.61 0 .88 1.19 1 .57 ... Examples of commodity exchanges are the New York Cotton Exchange, Chicago Mercantile Exchange, and Amex Commodities Exchange Since there is a chance of significant gains and losses in commodities, exchanges ... −0.0 85 7 0.0012 −0. 053 5 −0.04 65 −0.0227 0.16 95 0.0 055 −0.03 98 Period −0 .52 31 −0.1074 2.69 98 −0.4 984 0 .57 42 −0.2431 −0. 156 5 0. 087 4 −1.4329 3.0346 −0.0112 −0.0 455 −0.0794 0.0991 −0.0902 −0.2112 −0 .80 33...

Ngày tải lên: 05/08/2014, 13:20

... irinotecan PR 14% SD 43% Not given [20] 18 CCA, GBC Capecitabine RR 6% CCA RR 50 % GBC 8. 1 months CCA 9.9 months GBC [47] 20 GBC 20 extrahepatic CCC 16 intrahepatic CCC Capecitabine + oxaliplatin GBC ... 191 Real Common hepatic duct Cystic duct Hidden cystic duct Common bile duct Figure 10.11 The deception of the hidden cystic duct and the infundibular technique of laparoscopic cholecystectomy Left: ... (intrahepatic and extrahepatic), CCA, CCC: cholangiocarcinoma, GB: gallbladder 5FU: fluorouracil, MMC: mitomycin C, FAM: combination of fluorouracil, doxorubicin and mitomycin C, LV: leucovorin, IFN:...

Ngày tải lên: 09/08/2014, 14:22

... M, Carter DC Surgical options for pancreatic cancer In: Surgery of the pancreas Edinburgh: Churchill Livingstone, 1997: 383 -51 5 Cameron JL, Grochow LB, Milligan FD, Venbrux AC Pancreatic cancer ... pancreatic head resected Bottom: reconstruction with jejunal Roux loop Complications of chronic pancreatitis Pseudocysts Pancreatic pseudocysts are localised collections of pancreatic fluid resulting ... which may reduce gut permeability and bacterial translocation and limit infection in the necrotic pancreas Figure 10 .5 Ascaris lumbricoides in pancreatic duct: a rare cause of acute pancreatitis...

Ngày tải lên: 10/08/2014, 07:20

... time of the booster dose may give a good indication of a duration of adequate antibody titres 1 05 1 95 (a) 2 85 3 75 4 65 555 6 45 7 35 Number of infections 20 (b) 15 10 293 1 05 1 95 2 85 3 75 4 65 555 6 45 ... 20% of patients become icteric The symptoms resemble those of HCV Acute hepatitis Recovery ? 15% Chronic 85 % Inactive 25% ? Active 60% Cirrhosis Cancer Fig 18 .5 The natural history of HCV infection ... treatment of chronic hepatitis C: a randomised trial Lancet 2001; 3 58 : 9 58 72 Manzini P, Saracco G, Cerchier A et al Human immunodeficiency virus infection as risk factor for mother-tochild hepatitic C...

Ngày tải lên: 10/08/2014, 15:20

... usually a specific objective of the decision at hand, and the decision rules are structured in the context of this objective When there are multiple criteria which must be considered in the decision, ... have a technical background), to assist in gathering information and exploring scenarios Because of the inaccessibility of data and modeling tools, decision makers must consult their technical support ... human activities and their environmental impacts are associated with a place having its own characteristics which influence the decision Multidisciplinary, requiring consideration of issues crossing...

Ngày tải lên: 11/08/2014, 13:22

... c3 c4 12 c5 b2 a1 15 c6 18 c7 21 c8 b3 b5 b6 b7 b8 a3 b9 24 27 30 33 36 42 45 48 51 54 57 Figure 11.3 A full index tree 39 60 63 66 69 72 75 Replicated Part Non-Replicated Part 78 c9 c1 0 c1 1 c1 2 ... c9 c1 0 c1 1 c1 2 c1 3 c1 4 c1 5 c1 6 c1 7 c1 8 c1 9 c2 0 c2 1 c2 2 c2 3 c2 4 c2 5 c2 6 c2 7 b4 a2 I 256 DATA BROADCAST igation together with the sparse index tree provides the same function as the complete index ... d e C 2,1 C 2,2 C 3,1 C 3,2 Slow f g C 3,3 C 3,4 a b d a c e a b f a c g C 1,1 C 2,1 C 3,1 C 1,1 C 2,2 C 3,2 C 1,1 C 2,1 C 3,3 C 1,1 C 2,2 C 3,4 Minor Cycle Figure 11.1 An Example of a seven-item,...

Ngày tải lên: 13/08/2014, 12:21

... transfectant and introduced to cells for hour 11 Table DNA Oligonucleotides Primer name Sequence (5' →3') Sense ATACCGTCCCACCATCGGGC Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT 30A CCCCTATCCTTTCCGCGTCCTTACTTCCCC ... intense band at 150 kDa was observed, confirming that Ku80CTR is in fact covalently bound to Ku70 /80 C (Figure 11d) Upon comparison of the Ku80CTR specific band at 150 kDa and the Ku70 and Ku80 C antibody ... presence or absence of Ku70 /80 C and could be indicative of a Ku80CTR specific interaction The second form of crosslinking was 1-ethyl-3-[3dimethylaminopropyl]carbodiimide hydrochloride (EDC) coupling...

Ngày tải lên: 24/08/2014, 11:02

... Account Policy x, is on top of the list 12 Click OK, and then close Active Directory Users and Computers 13 Run the C: \MOC\Win 155 8A\Labfiles\Replicate.cmd command file to force your recent changes ... logoff Full Action on server disconnect Work offline Close Group Policy 10 Click Close 11 Close Active Directory Users and Computers 12 Run the C: \MOC\Win 155 8A\Labfiles\Replicate.cmd command ... Open Active Directory Users and Computers Right-click the user account that you created for yourself, and then click Properties Click the Account tab Notice that the Account locked out check box...

Ngày tải lên: 18/10/2013, 18:15

... (1994) The effect of extracellular pH and lactic acid on pH homeostasis in Lactococcus lactis and Streptococcus bovis Current Microbiology 28, 1 65 1 68 Dawson, K.A and Boling, J.A (1 983 ) Monensin-resistant ... re-assessment of bacterial growth efficiency: the heat production and membrane potential of Streptococcus bovis in batch and continuous culture Archives of Microbiology 155 , 55 9 56 5 Russell, J.B ... Escherichia coli Biochimica et Biophysica Acta 85 1 , 223 2 28 Neidhardt, F .C. , Ingraham, J.L and Schaechter, M (1990) Physiology of the Bacterial Cell Sinsauer Associates, Incorporated, Sunderland,...

Ngày tải lên: 07/11/2013, 23:15

... safety 7 .5 7 .5 Certification and EC marking Certification and EC marking There are steps in the process of machinery certification and EC marking: application of all relevant directives and standards, ... interpretation of C1 , C2 , C3 and C4 , the consequences of the accident and normal healing shall be taken into account See comment above This parameter takes into account: • operation of a process (supervised ... for the compliance of the product 173 7 Personnal and machines safety 7 .5 Certification and EC marking b Conformity assessment According to article of the Machinery Directive the manufacturer...

Ngày tải lên: 15/02/2014, 08:44

... Agencies (CNPq, CAPES, FAPERJ, and FAPESP); the Bulgarian Ministry of Education and Science; CERN; the Chinese Academy of Sciences, Ministry of Science and Technology, and National Natural Science ... Foundation of China; the Colombian Funding Agency (COLCIENCIAS); the Croatian Ministry of Science, Education and Sport; the Research Promotion Foundation, Cyprus; the Estonian Academy of Sciences and ... Funding Agencies (ETH Board, ETH Zurich, PSI, SNF, UniZH, Canton Zurich, and SER); the National Science Council, Taipei; the Scientic and Technical Research Council of Turkey, and Turkish Atomic Energy...

Ngày tải lên: 07/03/2014, 17:20

... Environmental Science and Technology 23, 88 1 88 7 Bogen, D C. , Nagourney, S J and Torquato, C. : 1 980 , ‘A field evaluation of the HASL wet-dry deposition collector’, Water, Air, and Soil Pollut 13, 453 – 4 58 Brechtel, ... 12 35 – 2700 152 0 2270 3900 – 359 0 3600 970 6 6 16– 25 10 Sampled trees 340 81 6 9 18 10 05 340 1061 10 05 81 6 1637 9 18 1046 1639 10 05 2130 Incident rainfall (mm)b 61% 57 % 77% 84 % 80 % 65% 76% 68% 59 % ... 10% of the mean with a 95% confidence level In beech stands, Weihe (19 85 ) calculated that 30 to 80 collectors were necessary to yield estimates of stemflow volumes with a precision of 10% and a 95% ...

Ngày tải lên: 23/03/2014, 23:20

... foreign currency In functional currency 450 ,000 6 75, 000 Interest income for months to 31 December 2011 converted at average rate of 1.6 19,7 08 31 ,53 3 Coupon received on 31 December 2011 converted ... disclosure Disclosures as at 31 December 2011 How calculated Method How calculated ( 350 ) The sales price of 3, 150 less the fair value on 31 December 2010 of 3 ,50 0 ( 350 ) The sales price of 3, 150 less ... IFRS Practice Issue publications, which discuss speciic requirements of pronouncements Disclosure checklist IFRS-related technical information also is available at kpmg.com/ifrs For access to...

Ngày tải lên: 30/03/2014, 03:20

... page Summary Chapter 2: Basic Functionality Modules Working with modules Forum Comments Search 10 11 13 14 15 16 18 19 21 22 22 24 26 30 31 39 41 45 48 49 50 52 54 58 61 Table of Contents Third-party ... Actions and triggers Shortcuts File system Performance Caching Bandwidth optimization Maintenance Logging and errors Clean URLs RSS publishing Reports Summary 63 64 67 69 69 72 75 84 85 86 87 ... 67 69 69 72 75 84 85 86 87 91 95 98 103 104 106 106 1 08 109 111 113 116 Chapter 4: Users and Access Control 117 Chapter 5: Basic Content 147 Planning an access policy Roles Permissions Users Administering...

Ngày tải lên: 29/05/2014, 15:44

... – 12) MDC90 % of scale width MCID MCID % of scale width 3* 5. 1 0.42 0.7 – 1.07 15. 0% 21.3% 7% 5. 8% – 8. 9% 4 .5 0.9 1. 15 – 2. 15 10.0% 18. 8% 15. 0% 9.6% – 17.9% * Bland and Altman 'limit of agreement' ... intraclass correlation coefficient (ICC), Pearson's r, Spearman's rho, Bland and Altman's limits of agreement [ 18] , the minimal detectable change with 90% (MDC90) or 95% (MDC 95) confidence intervals, ... internally consistent scale MacKnight and Rockwood [27] conducted principal components analysis and identified four factors with eigenvalues greater than one (13 .86 , 4.02, 1. 85 and 1. 15) The four components...

Ngày tải lên: 18/06/2014, 22:20