780 portion of the d flip flop transition table showing a noncritical race
Tess of the d'urbervilles
Ngày tải lên :
20/03/2014, 16:19
... cough as he does, and mother wouldn't always be washing.' 'And you would have been a ready-made rich lady, and not have to marry a gentleman/ 'Oh, Aby, don't - don't talk of that any more!' Abraham ... d' Urberville? Later that afternoon they left the dairy All the dairy people watched them leave, and Clare kissed the dairymaids goodbye As he was thanking the dairyman, a cock crowed just in front of him ... clear and light, and the river Froom rushed as fast as the shadow of a cloud Either the change in the quality of the air, or the feeling that parts of the valley It was half-past four, when the...
- 68
- 196
- 0
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx
Ngày tải lên :
23/03/2014, 13:20
... indicated in the figure legends (with pPac added to a total of 5.75 lg), and harvested days after transfection CAT and b-galactosidase activities were measured in extracts of transfected cells [24], and ... with medium until harvested days after transfection Sendai virus was added for the last 18 h of transfection Sendai virus was obtained from SPAFAS (North Franklin, CT, USA) and used at 200 hemagglutinin ... normal Arbitrary units rather than fold activation was used in most Figures herein so that the relative strength of reporters can be compared Basal activity of a reporter displayed the most variation...
- 11
- 487
- 0
Báo cáo khoa học: Inhibition of the D-alanine:D-alanyl carrier protein ligase from Bacillus subtilis increases the bacterium’s susceptibility to antibiotics that target the cell wall potx
Ngày tải lên :
30/03/2014, 16:20
... dLtA-P1, 5¢-ACAAATATAGACACCGAGCAAAATGG CAA; dLtA-P2, 5¢-CGAGCTCGAATTCGTAATCATGGT CATATTATAAATATATGAACCGCTATTCGCGGT-3¢ (3¢ kanamycin fragment underlined); dLtA-P3, 5¢-GTAT AATCTTACCTATCACCTCAAATGGTTCTCGTTTTTA ... toward all proteinogenic amino acids in addition to d- Ala and several other d- amino acids was determined Until now, no d- aa activating A- domain had been characterized All A- domains described so ... (DltA) Following activation by DltA, d- Ala is transferred to the 10 kDa d- alanyl carrier protein DltC which can donate d- Ala to lipoteichoic acids with the help of DltB and DltD to mediate the...
- 11
- 407
- 0
Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot
Ngày tải lên :
09/08/2014, 07:21
... procedure and contributed to the design of the study; GA and AM gathered the data, drafted the manuscript and critically revised it; IV, TT and GF revised and finally approved the manuscript ... abdomen depicting a mass Computed tomography of the abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal ... adenomas, familial adenomatous polyposis (FAP) and Crohn's disease It has been stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an...
- 4
- 202
- 0
Báo cáo y học: "Replication of association of the D-repeat polymorphism in asporin with osteoarthristis" docx
Ngày tải lên :
09/08/2014, 08:22
... susceptibility: case-control studies in Spanish Caucasians Arthritis Res Ther 2006, 8:R55 Kizawa H, Kou I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, et al.: An aspartic ... so, the association of asporin has been replicated in the European Caucasian population The low odds ratio given above suggests that the Spanish study might be under-powered to detect the low-risk ... similar to the conclusion of the authors of the UK study [3] Our conclusion was based in the analysis of the three available studies in Europeans [1,3,4] We were well aware of differences in allele...
- 3
- 267
- 0
Báo cáo y học: "Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese" potx
Ngày tải lên :
12/08/2014, 15:22
... closely related to decorin and biglycan J Biol Chem 2001, 276:12201-12211 15 Kizawa H, Kou I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, Uchida A, Nakamuna K, ... development of skeletal components; and it may also deduce the proliferation of fibroblast cells in tendon and fascia, and then loosen the tendon and fascia around a joint, which will make the joint easier ... Shirokanedai, Minato-ku, Tokyo 108-8639, Japan Authors’ contributions All authors contributed to the final manuscript In addition, DS and JD genotyped the samples and participated in the design and analysis...
- 5
- 273
- 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
Ngày tải lên :
18/02/2014, 16:20
... CAAX box of Ras1p (C-Vrp1p364)760–CAAX) Each strain was streaked for single colonies on YPUAD solid medium, incubated at either 24 or 37 °C, and photographed after days (B) Addition of a CAAX ... strain), AMY88 (MATa lys2 his4 leu2 ura3 vrp 1D: :KanMx bar1) [23], IDY166 (MATa his3 leu2 ura3 trp1 las1 7D: :URA3) [20], and PJ69- 4A (MATa his3 leu2 ura3 trp1 gal 4D gal8 0D met2::GAL7-lacZ GAL2-ADE2 ... polymerization may play a critical role in actin filament assembly in the actin patch Binding of the LBD to Las17p may also stimulate Las17p-dependent activation of the 4118 Arp2 ⁄ complex De novo actin...
- 23
- 679
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
Ngày tải lên :
06/03/2014, 22:21
... began at s and ended at 180 s Table Affinity parameters for NTD–FnBR interactions The parameters were determined by SPR measurements, with immobilized FnBRs of FnBPA and FnBPB as ligands and the ... were washed and further incubated with rabbit polyclonal antibody against Fn Binding of the polyclonal antibody (B) or the mAb (D) to the filters was visualized with HRP-conjugated goat anti-(rabbit ... (HRP)-conjugated goat anti-(rabbit IgG) (1 : 1000 dilution; DakoCytomation, Glostrup, Denmark) for 45 The binding of the secondary antibody was quantified by adding the substrate o-phenylenediamine dihydrochloride...
- 16
- 560
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
Ngày tải lên :
07/03/2014, 03:20
... acetate (1 mgÆmL)1) was added as internal standard to each assay prior to extraction The conversion rates were determined by calculating the decrease of substrate peak areas measured at their individual ... yielding a C17 dialdehyde To confirm their nature, the dialdehyde products, 1, and 5, were purified and analyzed by LC-MS In order to stabilize the C14 dialdehyde (product 1), it was derivatized ... dialdehydes in the sum of their peak areas calculated by integrating each peak at its individual kmax Data represent the average of six independent incubations accumulating E coli cells, and volatile...
- 12
- 497
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
Ngày tải lên :
15/03/2014, 10:20
... Biophysical properties of hGBP 5a ⁄ b and hGBP5ta M Wehner and C Herrmann hand, interact dynamically with the bound nucleotide, and usually bind nucleotides in the micromolar range In addition to these ... tetrabutylammonium bromide, 0.2 mm sodium azide and 1.25% acetonitrile at pH 6.5 Elution times were measured using GMP, GDP and GTP (all purchased from Sigma-Aldrich) as calibration standards Data were ... using a quadratic binding equation yielded the dissociation constants summarized in Table The splice variants 1600 Fig Fluorescence titration data showing similar dissociation constants for binding...
- 9
- 462
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
Ngày tải lên :
23/03/2014, 13:20
... of the most critical parameters of the pathway regarding this goal requires the knowledge of the intracellular concentrations of all metabolites involved and a kinetic model that accurately describes ... useful against trypanosomatids The intracellular concentration of trypanothione is another critical parameter that will lead to an increase of the steady-state concentration of methylglyoxal Again, ... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration...
- 11
- 515
- 0
Báo cáo khoa học: Characterization of surface n -alkanes and fatty acids of the epiphytic lichen Xanthoria parietina, its photobiont a green alga Trebouxia sp., and its mycobiont, from the Jerusalem hills pot
Ngày tải lên :
23/03/2014, 17:21
... It is probably an artefact of the GC analysis Mycobionts produce saturated fatty acids such as tetradecanoic acid (5–9%), hexadecanoic acid (34–37%) and octadecanoic acid (23–30%) (Table 1) Three ... of alkanes, and found that the main ones were C27, C29 and C31 The alkanediene C17H32 and normal alkanes in the C9–C17 range, with the C17 alkadiene as the major hydrocarbon, were detected Other ... analysis of the hydrocarbons and fatty acids of X parietina, its photobiont and mycobiont collected from four different locations indicated the presence of 27 n-alkanes and six major fatty acids Quantitative...
- 6
- 613
- 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot
Ngày tải lên :
29/03/2014, 07:20
... 36% CDO-squared 4% Mortgage bonds AAA AA A BBB BB-unrated 80% 11% 4% 3% 2% CLO 36% Mezzanine CDO Senior AAA 62% Junior AAA 14% AA 8% A 6% BBB 6% Unrated 4% CDO-squared (CDO of CDO) Senior AAA Junior ... of the appreciated value of the collateral property The share of the appreciated value is determined and due at the sale of the property or at the termination of the mortgage In addition to promoting ... Buildup and Meltdown of the Mortgage and Credit Markets The demand for residential real estate was seemingly insatiable After rising at an average annual rate of slightly less than percent during...
- 51
- 467
- 0
Báo cáo khoa học: Tumor suppressor p16INK4a: Downregulation of galectin-3, an endogenous competitor of the pro-anoikis effector galectin-1, in a pancreatic carcinoma model pptx
Ngày tải lên :
29/03/2014, 21:20
... using isolated and denatured cDNA fragments immobilized on Hybond N+ nylon membranes (Amersham Pharmacia) The amount of denatured cDNA for Gal-1, GAPDH and b-actin blotted was 5, and lgÆslot)1, ... blot analysis from extracts obtained under the conditions described above and analyzed with anti-Gal-3 or anti-PCNA Ig as indicated (C) Poly- (A+ ) RNAs were isolated from mock-transfected and p16INK 4a- expressing ... glycan remodeling affords an attractive level of regulation of integrin functionality The assumption of a modulatory impact of p16INK 4a at the level of glycosylation was a reasonable and testable...
- 12
- 373
- 0
Báo cáo khoa học: Protein expressed by the ho2 gene of the cyanobacterium Synechocystis sp. PCC 6803 is a true heme oxygenase pot
Ngày tải lên :
30/03/2014, 15:20
... 50 after the start of the reaction (dashed line); after the addition of biliverdin reductase (dotted-dashed line) In the ascorbate system (B and D) , NADPH was added together with biliverdin reductase ... to that of bilirubin by the addition of biliverdin reductase and NADPH A previous study on rHO-1 indicated that when ascorbate was used as a reductant, the final heme degradation product was not ... chromatography on Sephadex G-75, DE-52, and hydroxyapatite The final preparation after chromatography on a hydroxyapatite column was clear and colorless and gave a single band of 29 kDa with about...
- 11
- 347
- 0
Management and Financial Audit of the Hawaii Tourism Authority’s Major Contracts A Report _part1 ppt
Ngày tải lên :
18/06/2014, 20:20
... Audit of the Hawai`i Tourism Authority's Major Contracts A Report to the Governor and the Legislature of the State of Hawaii Conducted by The Auditor State of Hawaii and Nishihama & Kishida, ... (HRS), to direct the Auditor to conduct a management and financial audit of all contracts or agreements awarded by the Hawai`i Tourism Authority to a major contractor every five years Each audit is ... adequacy of the financial records and accounting and internal controls, and they determine the legality and propriety of expenditures Management audits, which are also referred to as performance audits,...
- 10
- 376
- 0
Management and Financial Audit of the Hawaii Tourism Authority’s Major Contracts A Report _part2 ppt
Ngày tải lên :
18/06/2014, 20:20
... Specifically, the authority could not justify the contracts it awarded and did not adequately monitor all contracts In 1993, the office conducted a Management and Financial Audit of the Hawai`i ... (Tokyo and Osaka) and two in the People’s Republic of China (Beijing and Shanghai) HVCB representatives can be found in Canada, Germany, United Kingdom, Australia, New Zealand, Korea, Taiwan, Hong ... Today, HVCB has a worldwide presence In addition to its corporate headquarters in Honolulu, the bureau also maintains offices on each of the major neighbor islands and around the world In the...
- 10
- 448
- 0
Management and Financial Audit of the Hawaii Tourism Authority’s Major Contracts A Report _part3 pptx
Ngày tải lên :
18/06/2014, 20:20
... China and Japan offices indicate varying degrees of improper management of state funds The Kaua‘i Visitor’s Bureau has a staff of four state-funded positions and an executive director who is paid ... represented that the severance packages were established with the authority’s agreement The authority disagreed, stating that authority officials had neither requested the severance packages nor had ... Nippon Airways (ANA), Northwest, United, and China Airlines Under an unusual arrangement, JAL pays a portion of the Japan vice president’s salary and provides the vice president with JAL benefits...
- 10
- 397
- 0
Management and Financial Audit of the Hawaii Tourism Authority’s Major Contracts A Report _part4 doc
Ngày tải lên :
18/06/2014, 20:20
... contract, Wish Company serves as HVCB’s worldwide representative in Taiwan by promoting Hawai‘i in Taiwan and improving and maintaining the image of Hawai`i in Taiwan as a primary visitor and convention/incentive ... authority On a separate occasion, HVCB received state contract funds from the authority to conduct legal research regarding the authority’s attendance at HVCB board of directors and marketing advisory ... Bureau to Exploit State Contract Funding The authority also agreed to contracts that did not have clearly defined goals and objectives As a result, the authority was unable to adequately assess...
- 10
- 338
- 0