6 7 influence of pre exponential factor a surface temperature vs time and b surface temperature vs pre exponential factor
Pyrolysis and combustion processes of combustible materials under external heat flux
Ngày tải lên :
09/09/2015, 11:28
... on surface < /b> temperature < /b> 142 6.< /b> 6 Influence < /b> of < /b> heat of < /b> pyrolysis on mass loss rate 143 6.< /b> 7 < /b> Influence < /b> of < /b> pre-< /b> exponential < /b> factor < /b> 145 6.< /b> 8 Influence < /b> of < /b> pre-< /b> exponential < /b> factor < /b> on mass ... must be capable of < /b> simulating fire behaviors of < /b> different types of < /b> combustible materials Because of < /b> various fire behaviors of < /b> these four types of < /b> combustible materials, it is challenging and < /b> significant ... FiresCone is capable of < /b> simulating fire behaviors of < /b> combustible materials in both solid and < /b> gas phases The generality of < /b> FiresCone allows fire professionals and < /b> materials formulators to simulate pyrolysis...
- 321
- 496
- 0
Tài liệu Preface, Contents Product Overview Getting Started1 2 3 4 5 6 7 8 9 10 11 12 A B C D E F pdf
Ngày tải lên :
25/01/2014, 21:20
... supply boundaries and < /b> I/O boundaries to AC circuits are rated 1500 VAC These isolation boundaries have been examined and < /b> approved as providing safe separation between AC line and < /b> low voltage circuits ... AC[accumulator number] AC0 MSB AC2 (accessed as a < /b> byte) AC1 (accessed as a < /b> word) MSB 15 LSB LSB Most significant Least significant Byte Byte AC3 (accessed as a < /b> double word) MSB 31 24 23 16 < /b> 15 Most ... provide a < /b> clearance of < /b> at least 25 mm above and < /b> below the devices Also, allow at least 75< /b> mm of < /b> depth Tip For vertical mounting, the maximum allowable ambient temperature < /b> is reduced by 10° C...
- 494
- 3.6K
- 0
HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc
Ngày tải lên :
22/03/2014, 15:21
... 6-< /b> 41 6-< /b> 43 6-< /b> 43 6-< /b> 43 6-< /b> 44 6-< /b> 46 < /b> 6- 46 < /b> 6- 46 < /b> 6- 47 < /b> 6-< /b> 47 < /b> 6-< /b> 47 < /b> 6-< /b> 47 < /b> 6-< /b> 47 < /b> 6-< /b> 48 6-< /b> 49 6-< /b> 50 6-< /b> 51 6-< /b> 52 6-< /b> 54 6-< /b> 54 6-< /b> 55 6-< /b> 57 < /b> 6-< /b> 57 < /b> 6-< /b> 57 < /b> 6-< /b> 59 6-< /b> 60 6-< /b> 60 6-< /b> 61 6-< /b> 62 6-< /b> 66 < /b> 6 - 67 /b> 6-< /b> 68 6-< /b> 68 6-< /b> 69 6-< /b> 69 6-< /b> 69 0 -7 < /b> hp3hp5shTOC.fm ... 3 -60< /b> Table 3 -61< /b> Table 3 -62< /b> Table 3 -63< /b> Table 3 -64< /b> Table 3 -65< /b> Table 3 -66< /b> Table 3 - 67 /b> Table 3 -68< /b> Table 3 -69< /b> Table 3 -70< /b> Table 3 -71< /b> Table 3 -72< /b> Table 3 -73< /b> Table 3 -74< /b> Table 3 -75< /b> Table 3- 76< /b> < /b> Table 3 -77< /b> ... HiPath 5000 RSM 6-< /b> 70< /b> 6-< /b> 71< /b> 6-< /b> 73< /b> 6-< /b> 73< /b> 6-< /b> 74< /b> 6-< /b> 75< /b> 6-< /b> 75< /b> 6-< /b> 76< /b> < /b> 6 -77< /b> 6-< /b> 77< /b> 6-< /b> 80 6-< /b> 81 6-< /b> 82 6-< /b> 83 6-< /b> 83 6-< /b> 84 6-< /b> 84 6-< /b> 84 6-< /b> 86 < /b> 6- 86 < /b> 6- 87 < /b> 6-< /b> 88 6-< /b> 90 6-< /b> 91 6-< /b> 91 6-< /b> 91 6-< /b> 91 6-< /b> 92 6-< /b> 92 6-< /b> 93 6-< /b> 94 6-< /b> 94 6-< /b> 96...
- 860
- 6.4K
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
Ngày tải lên :
03/11/2012, 09:57
... 1 26-< /b> 1 36 < /b> 1 27 < /b> Introduction Impaired monocyte function has been described in sepsis and < /b> has been characterised by inadequate respiratory burst, activation, antigen presentation and < /b> lowered expression ... Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates (Nunc, Denmark) were coated overnight at 4˚C ... 1(3): 1 26-< /b> 1 36 < /b> 129 Following an incubation and < /b> washing, the primary detection antibody was added, a < /b> mouse anti human IgG1 anti-HLA-DR (CR3/43) (Dako, Denmark), at a < /b> concentration of < /b> µg/ml After a < /b> 2h...
- 11
- 618
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
Ngày tải lên :
08/03/2014, 08:20
... 2 67 /b> 104 103 75< /b> 87 < /b> 1 57 < /b> 49 90 177< /b> 119 1 07 < /b> 2850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga ... 1 87 < /b> 104 103 75< /b> 87 < /b> 1 57 < /b> 49 90 1 76< /b> < /b> 119 1 07 < /b> 277< /b> AGAGTAaagt GCCAAGacgt GAGAAAgagt TTGCAGgaga ACCACGgggt CTGCAGgcgg ACCACGgcgt CACACGacgt GACCAGgggt CTGAAGgatg CTCAGGgagt GGACGGgagt 2 170< /b> 7 1 371< /b> 5 253 458 ... TGAGCAAAGTCTTCAATG-3¢ and < /b> 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and < /b> 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and < /b> the primers 5¢-GGAATTCATGCCGACCACAACCGTT...
- 12
- 507
- 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx
Ngày tải lên :
30/03/2014, 13:20
... internal salt bridges between residues D4 or E5 and < /b> R8, between E7 and < /b> K11, and < /b> between E13 and < /b> R 16,< /b> as analyzed in a < /b> further ´ study (S Belbeoc’h, J Leroy, A < /b> Ayon, J Massoulie & S Bon, unpublished ... A6< /b> 3 [ 26]< /b> overnight at °C, with gentle agitation on a < /b> rotating wheel, followed by addition of < /b> 80 lL of < /b> a < /b> 10% suspension of < /b> BSA-saturated washed beads and < /b> incubation for h After immunoadsorbtion, ... assayed for AChE, b- galactosidase and < /b> alkaline phosphatase activities Electrophoresis in nondenaturating polyacrylamide gels was performed as described previously [24] and < /b> AChE activity was shown...
- 15
- 333
- 0
the handbook of international adoption medicine a guide for physicians parents and providers dec 2004
Ngày tải lên :
11/06/2014, 10:37
... unusual, in part because of < /b> barriers of < /b> language and < /b> distance Historical Aspects of < /b> Adoption Adoption has always been a < /b> part of < /b> human history Adoption is mentioned in the Babylonian code of < /b> Hammurabi ... Colombia, and < /b> 189 from Thailand.24 In Spain there were 3022 international adoptions in 2000, from Colombia, China, India, Romania, and < /b> Nicaragua. 26 < /b> Children from Guatemala and < /b> Russia are being adopted ... York Auckland Bangkok Buenos Aires Cape Town Chennai Dar es Salaam Delhi Hong Kong Istanbul Karachi Kolkata Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi São Paulo Shanghai Taipei...
- 465
- 584
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
Ngày tải lên :
19/06/2014, 10:20
... fear of < /b> falling that appears to be related to this increased stride variability, and < /b> have an increased risk of < /b> falls [8,9] Further, the extrapyramidal, limbic systems, and < /b> the frontal lobe apparently ... the average stride time,< /b> average swing time,< /b> stride time < /b> variability, and < /b> swing time < /b> variability were determined Variability was calculated using the coefficient of < /b> variation (CV) of < /b> each subject's ... investigation Assessment of < /b> Gait Dynamics Previously described methods were used to quantify gait variability and < /b> evaluate gait dynamics of < /b> each walk [9, 27,< /b> 28] Briefly, to measure the gait rhythm and...
- 8
- 415
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part1 ppt
Ngày tải lên :
20/06/2014, 02:20
... Congress As of < /b> June 30, 2001, the department managed approximately 200,1 76< /b> < /b> acres of < /b> land on the islands of < /b> Hawaii, Kauai, Maui, Molokai, and < /b> Oahu In accordance with the act, the department leases ... public accounting firm of < /b> Grant Thornton LLP We wish to express our appreciation for the cooperation and < /b> assistance extended by officials and < /b> staff of < /b> the Department of < /b> Hawaiian Home Lands Marion ... offices, and < /b> agencies of < /b> the State of < /b> Hawaii (State) and < /b> its political subdivisions Background The Department of < /b> Hawaiian Home Lands originated from Section 101, Hawaiian Homes Commission Act of < /b> 1920,...
- 10
- 379
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part2 pdf
Ngày tải lên :
20/06/2014, 02:20
... made in the department’s prior external financial audit and < /b> in Chapter of < /b> the State Auditor’s Report No 93-22, Management and < /b> Financial Audit of < /b> the Department of < /b> Hawaiian Home Lands, have been ... Division manages those Hawaiian home lands not used for homestead purposes, including residential, agricultural, and < /b> pastoral lands It manages and < /b> disposes of < /b> unencumbered lands for both long- and < /b> ... and < /b> experience about past and < /b> current events and < /b> assumptions about current conditions The estimated amount for doubtful accounts must be reasonable and < /b> supported by relevant information and < /b> adequate...
- 10
- 341
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part3 pdf
Ngày tải lên :
20/06/2014, 02:20
... Exhibits 2.1 and < /b> 2.2 Exhibit 2.1 Homestead Lease Awards Cumulative Totals FY1998-2001 Number of < /b> Homestead Lease Awards 7,< /b> 400 7,< /b> 192 7,< /b> 200 7,< /b> 000 6,< /b> 9 27 < /b> 6,< /b> 809 6,< /b> 800 6,< /b> 600 6,< /b> 5 47 < /b> 6,< /b> 400 6,< /b> 200 19 97-< /b> 98 ... intervals and < /b> preparing reports to facilitate loan monitoring The department should maintain current and < /b> accurate information on all guaranteed loans Agencies that hold loans guaranteed by the department ... Source FY19 97-< /b> 98 to FY1999-00: Department of < /b> Hawaiian Home Lands annual reports Source FY2000-01: Department of < /b> Hawaiian Home Lands, "Homestead Area and < /b> Islandwide Applications Waiting List Monthly...
- 10
- 265
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part4 doc
Ngày tải lên :
20/06/2014, 02:20
... State of < /b> Hawaii: We have audited the combined financial statements of < /b> the Department of < /b> Hawaiian Home Lands, State of < /b> Hawaii, except for the allowance for loan losses, as of < /b> and < /b> for the fiscal ... combined financial statements referred to above present fairly, in all material respects, the financial position of < /b> the Department of < /b> Hawaiian Home Lands, State of < /b> Hawaii, as of < /b> June 30, 2001, and < /b> ... that we plan and < /b> perform the audit to obtain reasonable assurance about whether the combined financial statements are free of < /b> material misstatement An audit includes examining, on a < /b> test basis, evidence...
- 10
- 207
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part5 pdf
Ngày tải lên :
20/06/2014, 02:20
... 2 26,< /b> 185 2 16,< /b> 651 211 , 67 /b> 1 2 06,< /b> 564< /b> 201, 4 67 /b> 141, 468< /b> 135,249 70< /b> ,9 37 < /b> 11 ,71< /b> 9 3 ,7 < /b> 76< /b> < /b> Total Note J – Commitments and < /b> Contingencies $78< /b> ,895 69< /b> ,812 62< /b> ,4 57 < /b> 54 ,77< /b> 8 47,< /b> 074< /b> 39,319 31,399 23,348 15, 969< /b> 9, 270< /b> ... bonds allocated to the department under acts of < /b> various Session Laws of < /b> Hawaii These bonds are backed by the full faith, credit, and < /b> taxing power of < /b> the State Repayments of < /b> allocated bond debts ... revenues from available lands and < /b> are due in annual installments through July 1, 2011 The balance of < /b> bonds payable as of < /b> June 30, 2001, are $800,000 and < /b> $13, 370< /b> ,000 for the unrefunded 1991 and < /b> 1999...
- 10
- 223
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part6 doc
Ngày tải lên :
20/06/2014, 02:20
... Variance Favorable (Unfavorable) - - (1 ,78< /b> 4 ,65< /b> 2) 14, 461< /b> ,65< /b> 2 14, 461< /b> ,65< /b> 2 - 12 , 67 /b> 7,< /b> 000 6,< /b> 100,000 60< /b> 6,000 5 , 67 /b> 0,000 301,000 $ (1 ,78< /b> 4 ,65< /b> 2) $ Budget Department of < /b> Hawaiian Home Lands State of < /b> Hawaii ... 15,9 16,< /b> 70< /b> 7 4,539 ,7 < /b> 36 < /b> 2 56,< /b> 177< /b> ,4 36 < /b> 17,< /b> 015,042 7,< /b> 578< /b> ,282 26,< /b> 542,329 475< /b> , 579< /b> 1,1 76< /b> ,< /b> 6 26 < /b> 70< /b> 2, 273< /b> 43,495,320 5, 278< /b> ,77< /b> 9 153,084,5 06 < /b> 828 ,70< /b> 0 Totals (Memorandum Only) Exhibit 3.1 This is trial version www.adultpdf.com ... (13,954,808) 27 < /b> ,69< /b> 6,401 5,8 46,< /b> 566< /b> 21, 265< /b> 21,828, 570< /b> - 13 ,74< /b> 1,593 3, 2 67 /b> ,310 428,122 6,< /b> 3 06,< /b> 8 07 < /b> 3 ,73< /b> 9,354 Fiduciary Fund Type Expendable Trust Department of < /b> Hawaiian Home Lands State of < /b> Hawaii Combined Statement...
- 10
- 222
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part7 doc
Ngày tải lên :
20/06/2014, 02:20
... 5 ,71< /b> 9 ,64< /b> 9 5 ,71< /b> 9 ,64< /b> 9 - 61< /b> 6,042 64< /b> 9,253 (2,329,000) $ $ Receipts Fund $ $ 7,< /b> 2 67 /b> , 077< /b> 2,142 , 67 /b> 4 (78< /b> 5,000) 2,9 27 < /b> , 67 /b> 4 5,124,403 2, 2 67 /b> ,5 26 < /b> 11 ,66< /b> 1,424 (9,393,898) 2,8 56,< /b> 877< /b> 4, 464< /b> ,332 4,3 96,< /b> 561< /b> 67 /b> ,77< /b> 1 - 7,< /b> 321,209 ... 2 46,< /b> 253 1 26 < /b> Native Hawaiian Rehabilitation Fund Department of < /b> Hawaiian Home Lands State of < /b> Hawaii Combining Schedule of < /b> Revenues, Expenditures, and < /b> Changes in Fund Balances – Special Revenue ... your staff if Aloh", I ~ Soon, HataiiaR Homes Chairman Commission Attach c: Benjamin The The 60< /b> The Honorable Robert Calvin Honorable Honorable J Bunda, K Y cay i: tano, Governor of < /b> Hawaii Pesident...
- 10
- 202
- 0
Financial Audit of the Department of Hawaiian Home Lands A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-13 September 2002_part8 pot
Ngày tải lên :
20/06/2014, 02:20
... of < /b> operations of < /b> only that portion of < /b> the financial , eporting entity of < /b> the State of < /b> Hawaii that is attributable to the transactionsof the Department ofHawaiian Home Lands, StateofHawaii In ... eneral of < /b> the United States Those standards require that we plan and < /b> perfonn the audit to pbtain reasonable assuranceabout whether the combined financial statementsare free of < /b> material fnisstatement ... pfinciples used and < /b> significant estimatesmade by the management, as well as evaluating the overall dombined financial statement presentation We believe that our audit provides a < /b> reasonablebasis f~r...
- 10
- 186
- 0
Financial Audit of the Department of the Attorney General A Report to the Governor and the Legislature of the State of Hawai`i Report No. 04-05 May 2005_part1 ppt
Ngày tải lên :
20/06/2014, 02:20
... State Auditor to conduct postaudits of < /b> the transactions, accounts, programs, and < /b> performance of < /b> all departments, offices, and < /b> agencies of < /b> the State of < /b> Hawai`i and < /b> its political subdivisions Background ... can be enacted, the statutes require that the measure be analyzed by the Office of < /b> the Auditor as to its probable effects Health insurance analyses examine bills that propose to mandate certain ... interpretation of < /b> federal statutes and < /b> federal common law The Land/Transportation Division provides legal services on all matters relating to the Department of < /b> Land and < /b> Natural Resources and < /b> the...
- 11
- 432
- 0
Financial Audit of the Department of the Attorney General A Report to the Governor and the Legislature of the State of Hawai`i Report No. 04-05 May 2005_part3 potx
Ngày tải lên :
20/06/2014, 02:20
... custodial and < /b> thus cannot be said to have a < /b> measurement focus Agency funds use the accrual basis of < /b> accounting to recognize receivables and < /b> payables and < /b> report only assets and < /b> liabilities Encumbrances ... our audit in accordance with auditing standards generally accepted in the United States of < /b> America and < /b> the standards applicable to financial audits contained in Government Auditing Standards, ... our audit in accordance with auditing standards generally accepted in the United States of < /b> America and < /b> the standards applicable to financial audits contained in Government Auditing Standards,...
- 11
- 276
- 0