6—application to a singly reinforced rectangular section
guide for the design and construction of externally bonded frp systems for strengthening concrete structures
Ngày tải lên :
24/10/2014, 21:59
... bond to the concrete substrate; flexural and shear strengthening of beams and slabs are examples of bond-critical applications Catalyst A substance that accelerates a chemical reaction and enables ... reactive agent that causes polymerization when added to a resin Also called hardener or initiator Debonding A separation at the interface between the substrate and the adherent material Degradation A ... Degradation A decline in the quality of the mechanical properties of a material Delamination A separation along a plane parallel to the surface, as in the separation of the layers of the FRP laminate...
- 45
- 790
- 0
UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 3. KEY FACTORS FOR A SUCCESSFUL ONLINE COMMUNITYNOTE pptx
Ngày tải lên :
08/03/2014, 20:20
... information rather than share it because of their organizational culture? • What legal and political factors can impact the success or failure of the community? Is there a law against using VoIP tools ... Boxes, Glocalization, and Networked Individualism” Pp 10-25 in Digital Cities II: Computational and Sociological Approaches, edited by Makoto Tanabe, Peter van den Besselaar and Toru Ishida Berlin: ... ways • Although facilitated by technology, these communities are profoundly influenced by social, cultural, environmental, organizational and technical factors • The social and cultural factors...
- 12
- 346
- 1
Huyền Chip - Chương 1 - Tập 2: This Time For Africa
Ngày tải lên :
07/12/2013, 10:50
... visa sang Ethiopia ba tháng Những tưởng có visa, có vé máy bay ung dung cất cánh, bị phen đau tim Cairo Số visa vào hẳn Ai Cập, mà phép vào khu vực Sinai Sinai thuộc Ai Cập, bán đảo có sách visa ... quyền Sudan cấp visa cho Lòng đau cắt, nước mắt đầm đ a, đành đặt vé bay thẳng từ Ai Cập xuống Ethiopia Để lấy visa Ethiopia chuyện đơn giản Ban đầu, xin visa từ đại sứ quán Ethiopia Ai Cập bị ... miễn visa cho muốn du lịch Để tiết kiệm tiền, chuyến bay Sinai - Ethiopia có cảnh Cairo, Ai Cập Khi xuống đến Cairo, phát hạ cánh sân bay nội đ a Cairo, tức thoải mái mà qua hải quan Thế tranh thủ...
- 3
- 713
- 0
Tài liệu Risk factors for domestic physical violence: national cross-sectional household surveys in eight southern African countries pdf
Ngày tải lên :
13/02/2014, 06:20
... full access to all data and take responsibility for the integrity of the data and accuracy of data analysis All authors read and approved the final manuscript Acknowledgements The eight national ... Herero, Kalanga, Kaonde, Kwangali, Lozi, Luvale, Mucua, Ndau, Ndebele, Nyanja, Oshiwambo, Portuguese, Ronga, Sena, Sesotho, Seswati, Setswana, Shangaan, Xitshwa and Xitsonga Each field team of seven ... fieldwork After training, coordinators translated, back-translated and piloted the common instruments in 29 languages: Afrikaans, Bemba, Changana, Chichewa, Chindali, Chitimbuka, Chona/Shona, Chope,...
- 13
- 754
- 0
Tài liệu Báo cáo khoa học: Computational processing and error reduction strategies for standardized quantitative data in biological networks doc
Ngày tải lên :
19/02/2014, 07:20
... dynamics for phosphorylated and total cytoplasmic STAT3 obtained by immunoblotting of cytoplasmic lysates, as well as immunoprecipitates (data not shown), demonstrated that our automated computational ... computational data processing is robust and reliably applicable for both methods These tools facilitate the standardized and automated generation of quantitative data and permit the cost-effective assembly ... immunoglobulin and quantified by LumiImager analysis (B) Time after Epo stimulation was plotted against the signals of HA-EpoR and the calibrator GST-EpoR A spline smoothing the calibrator signal was used to...
- 12
- 467
- 0
Associated factors for treatment delay in pulmonary tuberculosis in HIV-infected individuals: a nested case-control study docx
Ngày tải lên :
06/03/2014, 04:20
... Mfinanga SG, Mutayoba BK, Kahwa A, Kimaro G, Mtandu R, Ngadaya E, Egwaga S, Kitua AY: The magnitude and factors associated with delays in management of smear positive tuberculosis in Dar es Salaam ... da Saude Secretaria de Vigilancia a Saude Programa Nacional de DST/AIDS: riterios de definicao de casos de aids em adultos ecriancas Brasilia, Ministerio da Saude: Ministerio da Saude, Secretaria ... http://apps.who.int/ghodata/ Accessed in January 12/2012 Brasil Ministerio da Saude Departamento de Vigilância Epidemiologica Programa Nacional de Controle da Tuberculose; Avaliable at: http://portal...
- 11
- 479
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Ngày tải lên :
06/03/2014, 09:22
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... directly to p300 ⁄ CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...
- 10
- 434
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
Ngày tải lên :
07/03/2014, 03:20
... incubation assays using 30 lg of purified enzyme eluate For quantification, 200 lL of an acetonic solution of a- tocopherole acetate (1 mgÆmL)1) was added as internal standard to each assay prior to ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... of geranial, as observed in the fruits of several tomato and watermelon varieties [46], as well as in transgenic tomato fruits, where elevated carotenoid levels were accompanied by an increased...
- 12
- 497
- 0
Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx
Ngày tải lên :
16/03/2014, 05:20
... B12-dependent dehydratases and reactivating factors K pneumoniae as the genes encoding a reactivating factor for glycerol dehydratase and named them gdrAB (glycerol dehydratase-reactivating factor) genes ... that reactivating factor mediates the exchange of the enzyme-bound, adenine-lacking cobalamin for free, adenine-containing cobalamin toward a cognate dehydratase In addition, DDR can mediate a ... Recombinant DdrA and DdrB proteins as well as GdrA and GdrB form a tight a2 b2 complex and actually function as their reactivating factor – that is, they reactivate the glycerol-inactivated and O2-inactivated...
- 11
- 434
- 0
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx
Ngày tải lên :
16/03/2014, 10:20
... 327–329 33 Galeffi P, Lombardi A, Pietraforte I, Novelli F, Donato MD, Sperandei M, Tornambe A, Fraioli R, Martayan A, Natali PG et al (2006) Functional expression of a single-chain antibody to ErbB-2 ... ligand was detected by specific absorption at 550 nm Peak area values were calculated by smart manager software and plotted with kaleidagraph 3.52 software Nonspecific binding of cET-1 was monitored ... and binding kinetics were evaluated using biaevaluation 3.1 software In general, signals obtained from the Biacore assay were lower than expected for loading of ETBcHx as a relatively large analyte,...
- 13
- 433
- 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf
Ngày tải lên :
24/03/2014, 04:21
... Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA-30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA-30 (corresponding to amino-acid residues ... Education, Culture, Sports, Science, and Technology of Japan, the Organization for Pharmaceutical Safety and Research and KEIO University Special Grant-in-Aid for Innovative Collaborative Research ... indicate cyclin E, cyclin A and a dominant-negative form of cdk anti-FLAG Ig, we obtained a larger amount of 32P-labeled FLAG –p70ik3-1 from these cells (Fig 3A, lane of the upper panel) than that...
- 7
- 308
- 0
Obesity and Air Pollution: Global Risk Factors for Pediatric Non-alco- holic Fatty Liver Disease potx
Ngày tải lên :
29/03/2014, 18:20
... Takada G Serum alanine aminotransferase activity in obese children Acta Paediatr 1997;86(3):238-41 45 Alavian SM, Mohammad-Alizadeh AH, Esna-Ashari F, Ardalan G, Hajarizadeh B Non-alcoholic fatty ... feasible in large epidemiological studies, surrogate markers such as serum alanine/aspartate aminotransferases (ALT/AST) or ultrasonography are usually used to detect NAFLD (27) The normal range ... et al Particulate matter air pollution and cardiovascular disease: An update to the scientific statement from the American Heart Association Circulation 2010;121(21):2331-78 87 Hamabe A, Uto...
- 9
- 552
- 0
Recommended code of practice for the care and handling of poultry from hatchery to processing plant ppt
Ngày tải lên :
31/03/2014, 08:20
... morphological alterations 1.4 Identification devices attached to chickens 1.5 Euthanasia and disposal of nonsalable chicks 1.6 Euthanasia and disposal of unhatched embryos 1.7 Transportation of neonatal ... of any agency Organization Representative Agricultural Institute of Canada J.I Elliot, Ph.D Agriculture Canada Animal Health Division Animal Research Centre Engineering and Statistical Research ... Batte K Cassidy Canadian Broiler Hatching Egg Marketing Agency A LeVasseur 38 Canadian Chicken Marketing Agency J Judge W Klassen Canadian Council on Animal Care H.C Rowsell, D.V.M., Ph.D Canadian...
- 43
- 620
- 0
báo cáo hóa học: " Co-morbidity and visual acuity are risk factors for health-related quality of life decline: five-month follow-up EQ-5D data of visually impaired older patients" ppt
Ngày tải lên :
18/06/2014, 19:20
... age-related cataract and age-related macular degeneration (AMD) Due to demographic aging, these numbers are expected to increase and this group of patients will cause an increased demand for ophthalmic ... can be calculated These health state values are set on a scale ranging from (which corresponds to death) to (which corresponds to a state of perfect health) Negative values correspond to a state ... lower visual acuity values According to the World Health Organization, low vision is defined as a visual acuity < 0.3 (logMAR ≥ 0.52) and/or a visual field < 20°, and blindness as a visual acuity...
- 9
- 420
- 0
Peer Review Training – National Science Foundation August 1, 2011 Appendix C - Checklist for Review of Financial Audits Performed by the OIG potx
Ngày tải lên :
19/06/2014, 15:20
... Appendix B Staffing – Experienced financial statement auditors This is trial version www.adultpdf.com Fieldwork Standards AICPA GAGAS Planning & Supervision Internal Controls Sufficient Appropriate ... Conclusion The adequacy of the OIG’s policies and procedures are evaluated in Appendix A If reviewer concludes that the financial audit met professional standards, but… inadequate policies and procedures ... What I’ll Talk About Today Update Process Significant Changes Appendix C Details Questions This is trial version www.adultpdf.com Update Process In brief— FSAN working group Guidance – AICPA...
- 10
- 242
- 0
báo cáo hóa học:" A retrospective study of risk factors for poor outcomes in methicillin-resistant staphylococcus aureus (MRSA) infection in surgical patients" pptx
Ngày tải lên :
20/06/2014, 04:20
... MRSA bacteraemia, appropriate selection of empirical antimicrobial treatment has been shown to be a major prognostic factor [16] In these cases, newer Page of anti-staphylococcal agents, such as ... of all cases involved extracapsular and intracapsular hip fractures 68% of these cases were in females and 89% of these cases were in patients over the age of 65 Overall, 37% of intracapsular and ... discharge without complication) DEEP SUPERFICIAL Bacteraemia Surface wound swab Joint Aspirate Surface Exudates Page of as a ‘0’ and an adverse outcome (e.g necessary revision surgery due to deep...
- 6
- 458
- 1
báo cáo hóa học:" Migration and Risk Factors for HIV Acquisition in Pregnant Women in Baja California, Mexico" pptx
Ngày tải lên :
20/06/2014, 08:20
... relevant financial relationships Maria Rosario G Araneta, PhD, has disclosed no relevant financial relationships Jorge Ruiz-Calderon, MD, has disclosed no relevant financial relationships Patricia ... of migrating pregnant women, Tijuana General Hospital 2003 indicates Baja California; 2, Sinaloa; 3, Jalisco; 4, Michoacan; and 5, Chiapas received a blood transfusion for woman, spouse used other ... Accessed November 16, 2004 Viani RM, Ruiz-Calderon J, Van Pratt C, Lopez G, Spector SA: HIV prevalence during pregnancy in Tijuana, Baja California, Mexico AIDS 2003, 17:1113-1114 Abstract Page...
- 3
- 332
- 0
Báo cáo hóa học: " Investigation of utilization of nanosuspension formulation to enhance exposure of 1,3dicyclohexylurea in rats: Preparation for PK/PD study via subcutaneous route of nanosuspension drug delivery" doc
Ngày tải lên :
21/06/2014, 03:20
... unit surface area by weight (A/ W) was calculated to estimate the surface area reduction after the absorption took place, and the total residual surface area (RA) was calculated for each time ... The absorption efficiency (AE) was calculated by taking the ratio of the amount of drug available and was divided by the RA (AE = W/RA), and the absorption constant (K) was calculated as AE/δT All ... Y, Thurston A, Sommers C, Guzova J, Kahn L, Lai Y, Blom J: Pharmacokinetic and pharmacodynamic evaluation of the suitability of using fluticasone and an acute rat lung inflammation model to differentiate...
- 9
- 328
- 0