0

6  provide a link to other published apps in the market

Báo cáo khoa học:

Báo cáo khoa học: " Development of liver dysfunction under artificial nutrition: a reason to modify nutrition therapy in the intensive care unit" docx

Báo cáo khoa học

... Parenteral nutritionassociated hepatotoxicity Nutr Clin Pract 2004, 19:274-283 Kubota A, Yonekura T, Hoki M, Oyanagi H, Kawahara H, Yagi M, Imura K, Iiboshi Y, Wasa K, Kamata S, et al.: Total ... medical therapy In many cases the primary disease is the decisive cause of the development of liver dysfunction; intravenous or even enteral nutritional support may be an aggravating factor By ... carnitine can help to maintain hepatic functions Because it is known that ICU patients have a higher need for nutrients such as glutamine [8], an adequate exogenous supply within the frame of pharmaconutrition...
  • 2
  • 180
  • 0
Báo cáo y học:

Báo cáo y học: "Human immunodeficiency virus integrase inhibitors efficiently suppress feline immunodeficiency virus replication in vitro and provide a rationale to redesign antiretroviral treatment for feline AIDS" pdf

Báo cáo khoa học

... IN is similar to that of HIV-1 IN; and it is organized in C- and N- terminal domains, and a catalytic core domain (CCD) The C-terminal domain is likely to be involved in target (i.e., cellular) ... http://www.retrovirology.com/content/4/1/79 A increasing aa similarity B C Figure Proposed binding mode of integrase strand transfer inhibitors (INSTIs) to FIV integrase Proposed binding mode of integrase strand transfer inhibitors (INSTIs) ... employed The two metal ions were set to allow hexavalent coordination according to a Mg2+ type (i.e the metal thought to act as a co-factor in vivo) Carboxylate and carboxamide substituents on aromatic...
  • 13
  • 309
  • 0
 Báo cáo y học:

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Y học thưởng thức

... 2009, analyses included in the database were performed using the same “made in USA” equipment as in the included trials and were analyzed using the same software and hardware located at the central ... location in New York All MCG analyses in this database have been validated against the final medical and angiographic diagnoses, confirmed by two independent academic angiographers having access ... measured from the baseline A marginal tracing was defined by significant baseline fluctuations that did not meet the above criteria A good tracing had no significant baseline artifact or baseline...
  • 13
  • 684
  • 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

Quản trị kinh doanh

... • • The size and scope of the market; The segment in the market; The players in the market and their positions; The trends in all these areas 10 Market Analysis Market Analysis Market definition ... skilled and specialized discipline It concerns with managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations ... This chapter will review the literature involving building and maintaining brand The chapter will also highlight the importance of branding in the marketplace 2.2 What is a Brand? There are many...
  • 67
  • 974
  • 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Báo cáo khoa học

... (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as molecular mass markers alkaline phosphatase ... fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers Not only the aggregate but also the covalently ... TNSALP mutant protein that is degraded via the ubiquitin ⁄ proteasome pathway TNSALP (D289V), which is associated perinatal hypophosphatasia, is another example [14] These findings suggest that the...
  • 14
  • 445
  • 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Báo cáo khoa học

... 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), SPARC (forward, 5¢-GAGACCTGTGACCT GGACAATG-3¢; reverse, 5¢-GGAAGGAGTGGATTTAG ATCACAAGA-3¢), TGFBR2 (forward, 5¢-TGGACCCT ACTCTGTCTGTGGAT-3¢; ... 5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively As a negative control, we used an NT siRNA (5¢-UAGCGACUAAACACAUCAA-3¢) or a RISC-free siRNA (proprietary sequence) from Dharmacon ... upregulation of several mRNAs, although the underlying mechanisms are unclear siRNAs can activate dsRNA-dependent protein kinase and TLR3 pathways, leading to the activation of transcription factors...
  • 16
  • 494
  • 0
A Guide to Monte Carlo Simulations in Statistical Physics, Second Edition potx

A Guide to Monte Carlo Simulations in Statistical Physics, Second Edition potx

Vật lý

... configurations generated by simulation (histogram extrapolation, multicanonical sampling, Wang-Landau sampling, thermodynamic integration and so forth) The fact that simulations deal with small systems ... the older work often provides valuable pedagogical information for the student and may also be more readable than more recent, and more compact, papers An additional advantage is that the reader ... that the task of equilibrium statistical mechanics is to calculate thermal averages of (interacting) many-particle systems: Monte Carlo simulations can that, taking proper account of statistical...
  • 449
  • 1,994
  • 0
Underinsured or Uninsured? A Guide to Health Care Resources in Allegheny County doc

Underinsured or Uninsured? A Guide to Health Care Resources in Allegheny County doc

Sức khỏe phụ nữ

... Administration (HRSA) http://findahealthcenter.hrsa.gov/ HRSA maintains a national database of the federally funded health centers around the country that provide care to individuals without health insurance ... of information about various pharmaceutical patient assistance programs, state and local prescription assistance programs and disease specific programs A good place to research what is available ... Services Available: Free nursing services available to walk-ins during the day Family practice physicians usually available Tuesday evenings Podiatry is offered on the East listings continue on...
  • 38
  • 482
  • 0
jQuery Essentialsby Marc Grabanskiv2.We needed a hero to get these guys in line.jQuery ppt

jQuery Essentialsby Marc Grabanskiv2.We needed a hero to get these guys in line.jQuery ppt

Kỹ thuật lập trình

... Factory Method $() You can also pass $() a function to run the function after the page loads jQuery Factory Method $() You can also pass $() a function to run the function after the page loads ... “_blank” $(“form[id^=step]”) get all forms who’s id starts with “step” You can also string selectors together You can also string selectors together $(“#myId, myClass, table”) Find $(“div”) Find ... toggle(), animate() •Traversing find(), is(), prevAll(), next(), hasClass() jQuery Methods •Moving Elements: append(), appendTo(), before(), after(), •Attributes css(), attr(), html(), val(), addClass()...
  • 115
  • 191
  • 0
Báo cáo

Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf

Báo cáo khoa học

... Department The material is used as a resource rather than a script The teacher is going to examine it to see what learning opportunities it provides and design a curriculum that can add value to the tasks ... Autonomy in language teaching and learning, Language Teaching 40 (2006) 21 [6] D Little, Language learner autonomy: Some fundamental considerations revisited, Innovation in Language Learning and Teaching ... the real writing task and the chance that they are going to memorize, generalize, and maintain them is increased A plan for evaluating the effectiveness of the proposed solution This part proposes...
  • 8
  • 518
  • 4
addison-wesley developing hybrid applications for the iphone using html css and javascript to build dynamic apps for the iphone

addison-wesley developing hybrid applications for the iphone using html css and javascript to build dynamic apps for the iphone

Tin học

... one is the principal and the other is the delegate Principal has a has a Proxy/ Delegate Figure 1.9 A graphical representation shows a principal has a delegate, and a delegate has a principal Objective-C ... is Mammal is allocated space in RAM It is .The square brackets around Mammal and alloc indicate that the object in the application that represents the Mammal class is to be sent the alloc message.This ... is instantiated as shown in the following: var aMammal = new Mammal(“orange”, 0.15); You might think this is normal and expect other languages to behave in the same manner Objective-C instantiation...
  • 214
  • 538
  • 0
báo cáo sinh học:

báo cáo sinh học:" A national survey of ‘inactive’ physicians in the United States of America: enticements to reentry" potx

Điện - Điện tử

... was principal investigator and acquired the funding EAJ and HRR designed the survey SEB and HRR acquired the data HRR analyzed the data and all three authors interpreted the data, wrote the manuscript, ... grant from the American Medical Association Women Physicians Congress through the Joan F Giambalvo Memorial Scholarship, to aid in data acquisition, survey printing and mailing, and statistical ... efficient, as the timeframe for a reentry training program (variable from program to program) is substantially shorter than for training new physicians from scratch Reincorporating these physicians into...
  • 10
  • 552
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc

Báo cáo khoa học

... proportional to an increase in the design performance; – The changed investment intensity of logging and transport systems is not proportional to the change in performance Such a situation arises due to ... for the employment of machines with the rational performance Possibilities to determine the rational performance of machines are further discussed in this paper The objective of this paper was to ... from the analysis and from the determination of mathematic conditions required for reaching minimum specific emissions from logging and transport operations in the forest in relation to extracted...
  • 6
  • 341
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A reparameterization to improve numerical optimization in multivariate REML (co)variance component estimation" pdf

Báo cáo khoa học

... covariance matrices to be located close to the edge of the parameter space An obvious (at least in the context of DS) solution to the treatment of undefined covariance matrices is to assign a ’bad’ likelihood ... undefined parameters nearly undefined for the or that were within the parameter space, resulting in a substantial amount of conflicting directional information The situation was better in run 4, ... considered as the reference point Run was particularly impressive: with DS operating on the original covariance matrices, optimization was basically impracticable as computing time was at around...
  • 9
  • 251
  • 0
báo cáo khoa học:

báo cáo khoa học: " Part I, Patient perspective: activating patients to engage their providers in the use of evidencebased medicine: a qualitative evaluation of the VA Project to Implement Diuretics (VAPID)" pps

Báo cáo khoa học

... the healthcare provider can make the final decision Another approach could be to inform providers at the clinics of the letters and tell patients the providers are aware they may bring them to ... approach was chosen to minimize variation among interviewers and to facilitate a systematic means of gathering data and conducting analysis of responses, while at the same time allowing for individualized ... to a sample of predominately white male VA patients The findings may be unique to the VA, as many veterans appear to exhibit a sense of obligation that may influence their participation in and...
  • 11
  • 325
  • 0
báo cáo khoa học:

báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx

Báo cáo khoa học

... anterior gastrostomy (Figure 3) to ensure drainage from his stomach His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojejunostomy and a drain by the duodenal ... duodenal laceration following minor blunt abdominal trauma in the presence of a large pancreatic pseudocyst Minor blunt abdominal trauma in a normal healthy adult would not be expected to result in ... days post-trauma, he presented to our emergency department with severe upper abdominal pain On examination, our patient was found to be tachycardic, drowsy and in severe pain Abdominal examination...
  • 4
  • 251
  • 0
Báo cáo y học:

Báo cáo y học: " Part I, Patient perspective: activating patients to engage their providers in the use of evidencebased medicine: a qualitative evaluation of the VA Project to Implement Diuretics (VAPID)" ppsx

Báo cáo khoa học

... the healthcare provider can make the final decision Another approach could be to inform providers at the clinics of the letters and tell patients the providers are aware they may bring them to ... approach was chosen to minimize variation among interviewers and to facilitate a systematic means of gathering data and conducting analysis of responses, while at the same time allowing for individualized ... to a sample of predominately white male VA patients The findings may be unique to the VA, as many veterans appear to exhibit a sense of obligation that may influence their participation in and...
  • 11
  • 391
  • 0
báo cáo khoa học:

báo cáo khoa học: "A trial platform to develop a tailored theory-based intervention to improve professional practice in the disclosure of a diagnosis of dementia: Study protocol [ISRCTN15871014]" potx

Báo cáo khoa học

... finding that changing clinical practice is unpredictable and can be a slow and haphazard process Over the last decade a considerable body of literature has been published suggesting that a range ... rates and sample representativeness), and send reminders and financial incentives to those who have opted in (so as to enhance our response rate) Sample size and analysis The analysis will allow ... allow us to explain variation in both team and individual level behaviour The surveys will generate at least ordinal level quantitative data The relationships between predictor (i.e theoretical constructs...
  • 6
  • 334
  • 0
Báo cáo y học:

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Báo cáo khoa học

... vitro standard external positive sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 ... ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA ... cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive sense-specific QPCR primer CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative...
  • 11
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: " Does unrestrained single-chamber plethysmography provide a valid assessment of airway responsiveness in allergic BALB/c mice?" doc

Báo cáo khoa học

... Inspiratory time (TI); expiratory time (TE); relaxation time (TR), the time for the expiratory area to decline to 36% of the total expiratory area; peak inspiratory flow(PIF) and peak expiratory ... a protocol In addition, we had further analyzed the characteristics of the upper airway of the experiment mice, including the histology and nasal challenge with histamine The sneezing or nasal ... stored in formalin until further processing After dehydration and embedding in paraffin, a thickness of μm, the specimens were then deparaffinized and stained with hematoxylineosin Representative...
  • 11
  • 520
  • 0

Xem thêm