... increasing availability and performance A payback can often be realized by moving from a decentralized to a centralized environment If capacity management has already been implemented in a decentralized ... financial modeling based on real data effectively than traditional approaches • Provide greater visibility to net utilization (actual file system utilization, database-level utilization) • Establish ... Updating the Configuration Management Database (CMDB) with changes to configuration items (hardware, software, and associated documentation)—this ensures that information is up -to- to-date and...
Ngày tải lên: 26/10/2013, 22:15
... indicates when a category A can have a category B as a left-most descendant in a passe tree The matrix is static and can be derived from the grammar in advance of any pan ing It is computable as ... understands Classes are structured h/erarehically, and any class automaticaUy /nherits methods from its superclass • Smalltalk is an object-oriented language Instead of creating a procedure that ... GLIB In this approach we are in substantial agreement with Winograd (1984) who advocates a similar approach as an effective diroc finn for further naturul language resea~h (Technical Report CR-&t-12)...
Ngày tải lên: 21/02/2014, 20:20
THE GIRLS’ GUIDE TO BUILDING A MILLION-DOLLAR BUSINESS docx
... GUIDE TO BUILDING A MILLION-DOLLAR BUSINESS THE Susan Wilson Solovic AMERICAN MANAGEMENT ASSOCIATION New York ® Atlanta ® Brussels ® Chicago ® Mexico City ® San Francisco Shanghai ® Tokyo ® Toronto ... specialsls@amanet.org Website: www.amacombooks.org/go/specialsales To view all AMACOM titles go to: www.amacombooks.org This publication is designed to provide accurate and authoritative information ... necessary to achieve your dreams My mother always told me, “Leap and the net will appear.” —Tamara Monosoff, founder and CEO of Mom Inventors So far I’ve talked about the importance of tapping into...
Ngày tải lên: 05/03/2014, 20:20
Your Idea, Inc.: 12 Steps to Building a Million Dollar Business - Starting Today!
... your family, and earn some money, too The American Dream is still possible to attain today, especially when you consider how technology makes it easy to start a busi ness and have a virtual office ... Spanish it translates to "No go." Not a great name for a car! So, you need to a little research before you set it all in stone In order to see if anyone else has taken the name you want, again visit ... to believe that you really need a change and that you are capable of implementing it, one step at a time Jess Weiner, author and motiva tional speaker, says, "Your body knows you have a great...
Ngày tải lên: 15/03/2014, 15:21
Coaching High School Basketball : A Complete Guide to Building a Championship Team docx
... from a man -to- man to a zone, box and one, or triangle and two setup In any case, a quality motion offense can be used against a man-toman, as well as all types of zones such as the box and one, ... important rules was to never pass back; always pass ahead By passing back, a team has to beat the press twice because an opponent will set up a trap wherever players move to Also, we always tried to ... three lanes and go into a fast-break offense • passes to • flashes to middle as replaces (figs 5.10 and 5.11) • passes to 1, 3, or to start fast break Off and Running 33 4 X5 X3 X4 X2 5 X1 Pass Pass...
Ngày tải lên: 24/03/2014, 01:20
Knock Knock: Seth Godin’s Incomplete Guide to Building a Web Site that Works
... customer ought to see one page, preferably one based on her past behavior A customer who clicked on an AdWords ad for “Garage Door Openers” ought to see an offer for a garage door, not your standard ... traffic is predictable and scalable and makes you look smart So, you buy traffic Let’s get into a little detail about the smart way to that Everyone’s heard of Google, but a surprisingly small ... what are you trying to do? Have you got real clarity among the people on your team? A Web page isn’t a place the way Starbucks is a place A Web page is a step in a process The steps on the stoop...
Ngày tải lên: 27/05/2014, 12:52
WIN! A Leader''''s Guide to Building a Winning TeamLeader''''s Workbook ppt
... To so, utilize a weekly game plan Lay out what the objectives are for the week, and place TEAM goals against each objective These are specific goals that you want to have completed, or at least ... one To help support you in your endeavor to build a winning team, Winning Team Systems has collected a large number of tools and articles and have made them available to current and aspiring team ... updates and information to stop _ from starting Winning Team Environments embrace change, as they understand that in order to win, you need to make changes when necessary to your approach, ...
Ngày tải lên: 27/06/2014, 23:20
What kind of advice should you listen to? building a desire engine pdf
... High Habit Potential @nireyal NirAndFar.com Me @nireyal NirAndFar.com A bias to build first @nireyal NirAndFar.com How learn? @nireyal NirAndFar.com Patterns @nireyal NirAndFar.com NirAndFar.com ... habits @nireyal NirAndFar.com Habits > Viral Leaky Bucket Rocket Ship Spammy apps Facebook, Paypal, Pinterest Garbage Commitment Business Viral Coefficient (K) K >1 K
Ngày tải lên: 28/06/2014, 17:20
Anh văn lớp 7 - Unit one: Back to school A. Friends ( A1 + A3 ) docx
... class 7a What’s the new girl’s name? Nam is also in class 7a What class is she in? 3, Practice Listen and repeat Look at the books Who is also in class 7a? (15’) Tells the students to look at ... the tape Asks the students to look at the books and listen to the tape again Work in the small groups Let’s them work in the small groups students stand up and practice Calls some groups to practice ... the dialogue Explains the different between two sentences Nice to see you and Nice to see you again ( can replace see by meet) Answer the questions Opens the tape again Her name is Hoa Makes questions:...
Ngày tải lên: 03/07/2014, 16:21
slike bài giảng ứng dụng xây dựng hệ thống thông tin chương 6 the traditional approach to requirements
... that shows all main requirements for an IS in one diagram q q Processes q x Inputs / outputs Data storage Easy to read and understand with minimal training Data Flow Diagram Symbols DFD Fragment ... activities and interactions x Diagrams and other models of the traditional approach x RMO customer support system example shows how each model is related x How traditional and IE approaches and ... representing them on a data flow diagram x Describe how data flow diagrams can show the system at various levels of abstraction Learning Objectives (continued) x Develop data flow diagrams, data element...
Ngày tải lên: 24/10/2014, 15:36
6.1 CÁC NGUYÊN TỐ PHÂN NHÓM VA
... nguyên tố phân nhóm VA 6.1.3 Hợp chất nguyên tố phân nhóm VA Hợp chất nitơ: thể hợp chất nitrua với kim loại phi kim Hợp chất P, As, Sb, Bi: photphua, asenua, antimonua, bismutua Hợp chất với ... VO: tan nước, dễ tan axit tạo muối V(H2O)6+2 VCl2 chất khử mạnh Hợp chất Nb(+2) Ta(+2) có bền Hợp chất X(+3) Đặc trưng V2O3, không tan nước, tan axit VX3 (trihalogenua) tan nước dung môi ... XHal5, [X(OH)6]-… có tính oxy hoá tăng từ As →Bi 6.2 Các nguyên tố phân nhóm VB 6.2.1 Đặc tính nguyên tố phân nhóm VB Vanadi (V), Niobi (Nb), Tantan (Ta) Cấu hình electron (n-1)d3-4ns1-2 ...
Ngày tải lên: 12/07/2015, 18:09
Datapath Synthesis for a 16-bit Microprocessor
... transfer level synthesis The datapath components are taken from a RTL library that maps these components to their gate level equivalence The library also stores the delay parameters associated ... Critical path analysis Figure Design example two 10 ADDR control I/O Datapath MUX 16 IR Control 15:9 5:3 2:0 RF RAA RBA Next state logic 8:6 RWA PC 16 Bus Bus Bus Bus Bus SR AR DR 16 DATA AD ALU ... RTL style A. 1 RTL component Library 10 15 bit[ 31:0] { note note note note note alu (bit[ 31:0] a, bit[ 31:0] b, bit[ 2:0] ctrl) alu.library = "1"; alu .a= "data"; alu.b="data"; alu.sum="data"; alu.ctrl="control";...
Ngày tải lên: 02/07/2014, 12:46
AN0717 building a 10 bit bridge sensing circuit using the PIC16C6XX and MCP601 operational amplifier
... scale range and VRA3 (P to P) is equal to VRA3 (MAX) − VRA3 (MIN) or approximately VDD The system in this application note has been designed to have a full-scale input range to the comparator ... operational amplifier RA0OFF is the offset error caused by the leakage current of port RA0 This leakage current is specified at 1nA at room temperature and 0.5 A (max) over temperature This leakage ... have on hand includes: Are bypass capacitors included in the design? Is a low impedance ground plane implemented to minimize any ground noise across sensitive analog parts? Are appropriate anti-aliasing...
Ngày tải lên: 11/01/2016, 11:33
Lab 5.1.11 Building a Peer-to-Peer Network
... default Gateway is only required on local area networks that are connected to a router Computer IP Address Subnet mask Default Gateway PC – A 192 .168 .1.1 255.255.255.0 Not Required PC – B 192 .168 .1.2 ... they can be restored at the end of the lab These include IP address, subnet mask, default gateway, and DNS servers If the workstation is a DHCP client, it is not necessary to record this information ... the two PCs a Set the IP address information for each PC according to the information in the table b Note that the default gateway IP address is not required, since these computers are directly...
Ngày tải lên: 27/10/2013, 07:15
Lab 5.1.12 Building a Peer-to-Peer Network
... information in the table b Note that the default gateway IP address is not required, since these computers are directly connected The default gateway is only required on local area networks that are ... settings, so that they can be restored at the end of the lab These include IP address, subnet mask, default gateway, and DNS servers If the workstation is a DHCP client, it is not necessary to record ... to the NIC in each of the PCs Be sure to examine the cable ends carefully and select only a crossover cable b What kind of cable is required to connect from NIC to NIC? _ c What...
Ngày tải lên: 27/10/2013, 07:15
Tài liệu CHAPTER TwENTY ONE A BIOLOGICAL APPROACH TO A MODEL OF AESTHETIC ExPERIENCE OSHIN VARTANIAN AND MARcos NADAL pdf
... orbital frontal cortex was greater for stimuli classified as beautiful, and the authors argued that this activation in the orbital frontal cortex was due to the reward value of beautiful paintings ... processing along all five stages of the model The results indicate that evaluating a stimulus as beautiful was asSOCIated WIth mcreased activation in the orbital frontal cortex Activation in the orbital ... A Biological Approach to a Model of Aesthetic Experience 430 431 Chapter Twenty One flow has certain temporal characteristics associated with it This feature allows one to test the temporal...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
Ngày tải lên: 07/03/2014, 09:20
6 Steps to Building and Managing A Successful Social Media Marketing Team potx
... Steps to Building and Managing a Successful Social Media Marketing Team What social media content should we monitor and create? Your team will need to brainstorm ideas that will help, entertain and ... to past projects • A set beginning and end date for your strategy, after which your team will evaluate ROI and make any necessary changes to workflow and calendar Here’s an example of a how a ... the same quality and tone? • Are we creating content that we or our friends would like to read and share? www.awarenessnetworks.com Steps to Building and Managing a Successful Social Media Marketing...
Ngày tải lên: 25/03/2014, 14:22
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease
... control panel Each icon opens to a dedicated administration area of the back-end Alternate Administrator Access You can access additional areas of the administrator back-end using the top/left ... Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions Editor: Megan Belanger Project Editor: ... language If you want to install and develop your Website in another language, make the appropriate selection Joomla! accommodates a large number of international languages, and you can elect to...
Ngày tải lên: 29/05/2014, 23:54
joomla! 1.6 [electronic resource] a user's guide building a successful joomla! powered website
... core and third-party Joomla extensions We also examine how they are installed and managed in Joomla Chapter 7: Expanding Your Content: Articles and Editors There are two main ways to add and manage ... popular as a CMS As Joomla matures, it is being adopted by more and more organizations, from corporations to schools and universities to government organizations to newspapers and magazines to small ... ideas of what newsletter extensions are available, for example, head to Chapter 6, “Extending Joomla!” Finally, the appendixes contain valuable information about various aspects of Joomla Chapter...
Ngày tải lên: 31/05/2014, 01:25