6 recovering from a network failure
Tài liệu Concepts and Administration pptx
... either a single-instance Oracle database or an Oracle Real Application Clusters database A standby database can be either a physical standby database or a logical standby database: s Physical standby ... redo data to be archived first at the standby database s Role Management Services Change the role of a database from a standby database to a primary database, or from a primary database to a standby ... Primary Database and a Logical Standby Database 10-4 Primary and Logical Standby Databases After a Role Transition 10-6 Configuring a Primary Database with Physical and Logical Standby Databases...
- 474
- 1,318
- 1
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx
... the attrition re-weighted analyses The observed data are available in additional file Observed onset and persistence of restriction in any and each aspect of life at three years Page of 11 (page ... The reliability and validity of the KAP have been established as adequate for providing estimates of perceived participation restriction in population studies [34] Statistical analysis Data recorded ... older adults, we have shown that there is a substantial degree of change in participation status over a three-year period Nearly 30% of those who were participating "as and when they wanted" in all...
- 11
- 498
- 0
Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc
... Located in the northern part of Iran, the study areas are known as the Northern Forests or Hyrcanian Forests and are distributed across three provinces: Golestan, Mazandaran, and Gilan The majority ... bucking operations are carried out by manual chainsaws; however, logs are extracted by skidders from forest stands to a yard near the main road (Fig 3) As K (2007) indicated, from 1997 to ... timber and log pro- Fig Extracting squared timbers by animals duction and the relations between them in the Hyrcanian Forests of Iran during the last 20 years MATERIALS AND METHODS Areas under...
- 6
- 366
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... ture at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 12 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, ... supernatant after ultracentrifugation was loaded on the first column, a DEAE-Sepharose CL-6B (Pharmacia Biotech) equilibrated with 20 mM potassium phosphate pH 8.0, mM EDTA and 0.5 gÆL)1 dodecyl maltoside ... 2.8 a Mutants as published in [13] were re-analyzed side by side, and are presented for a complete overview b Km value taken from the highaffinity and kcat from the low -a nity phase c Pre-steady-state...
- 9
- 457
- 1
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... 22 pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based ... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases...
- 10
- 651
- 0
Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx
... M., Hara, M., Mai, L., Numayama-Tsuruta, K., Ishigaki-Suzuki, S., Ohuchi, K., Ichikawa, A. , Falus, A. , Watanabe, T & Nagy, A (2001) Mice lacking histidine decarboxylase exhibit abnormal mast cells ... Tanaka, S., Terni, T., Hori, Y., Makabe-kobayahi, Y., Pejler, G., Tchougonova, E., Hellman, L., Gutsenstein, M., Hirasawa, N., Sakurai, E., Buzas, E., Kovacs, P., Casaba, Gy, Kittel, A. , Okada, ... I., Nakajima, Y., Hirotsu, K & Kagamiyama, H (2003) Conformational change in aspartate aminotransferase on substrate binding induces strain in the catalytic group and enhances catalysis J Biol...
- 12
- 409
- 0
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf
... mutations were 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢, 5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢, 5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢, ... B-factor values ˚ All atoms (A2 ) ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) ˚ Substrate (A2 ) ˚ Water (A2 ) R.m.s DB values ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) Ramachandran plot statisticsf Favored (%) Allowed ... Ser425 Asp423 Asp423 Trp664 Trp664 Ala526 Ala526 Asp524 Asp524 Asp522 B Asp522 Asp636 (NAG1) Tyr590 NAG2 Asp636 (NAG1) NAG3 NAG4 NAG5 Tyr590 NAG2 NAG3 NAG4 NAG5 Trp664 Trp664 Glu526 Glu526 Ala524 Asp522...
- 13
- 514
- 0
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx
... archaea of the ANME-1 cluster, there is a codon for a valine, whereas in mcrA from methanogenic archaea, there is a codon for a glutamine [2] 4914 Methanogenic archaea and methanotrophic archaea ... Methanothermobacter marburgensis, MCR from Methanosarcina barkeri, and MCR from Methanopyrus kandleri [7] In case of the enzyme from Methanothermobacter marburgensis and Methanosarcina barkeri, the ... thioglycine (Methanoculleus thermophilus and Methanosarcina barkeri) or directly after the thioglycine (Methanosarcina barkeri), and an alanine instead of an aspartate two positions from the thioglycine...
- 9
- 548
- 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...
- 12
- 380
- 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... substrates with large, hydrophobic side chains (such as cephalosporin C and D-phenylalanine), as well as for a small and polar amino acid such as D-serine The Y238 mutants have a similar substrate ... Y238F DAAO mutant, consistent with a ternary complex mechanism For Y238S, as well as for wild-type DAAO [24], a parallel line pattern in the secondary plots was found instead Such a behaviour was ... range at 25 C Following absorbance at 455 nm, an initially rapid decrease in the oxidized avin absorption was observed, followed by a steady-state phase, and then by a further decrease to reach...
- 10
- 496
- 0
Report Development Tools Building Custom Reports in the R/3 System
... Giovannelli, and Patrick Zalamea (Ziatech Corporation) Pamela Anderson and Robert Smith (publishing consultants) Werner Aigner, Simone Baeumer, Tami Becker, Randi Bethel, Sylvia Chaudoir, Muge Das, ... of SAP AG SAP AG makes no warranties or representations with respect to the content hereof and specifically disclaims any implied warranties of merchantability or fitness for any particular purpose ... Elisa Davis, Ray Fan, Sampath Gomatam, Maria Gregg, Darrin Griggy, Reiner Herde, Michael Hielbrink, James Hill, Reiner Hoeltke, Claus Horn, Beverly Kennedy, Ruediger Kretschmer, Michael LaStella,...
- 16
- 657
- 0
Fill in the gaps 3
... such as 'isn't' and 'doesn't' k …materials such as nylon as well as natural materials such as cotton l …it is unlikely that man will be able travel to other galaxies Don't forget to keep a record ... teaching assistants in order to _ undergraduates a instruct b drill c inform 10 Cigarette packets on sale are required to carry a _ clearly stating the dangers of smoking a label ... suppress any newspaper reports which contain bad news 10 Examination candidates are not allowed to eat, drink, smoke or talk for the time / duration of the examination 11 The UK Government can decide...
- 13
- 649
- 1
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx
... protocols so that Internet access and usage is appropriate in all transactions The organization and its leaders would maintain a fundamental respect for employees as well as each other Internal business ... company and other organizational leaders have a common understanding and agreement about the importance of trust, the nature of organizational trust, and an assessment of the climate of trust that ... exploratory factor analysis with varimax rotation was conducted on the 18 measures The factor analysis revealed four factors and explained 64.36% of the variance in the data Table shows the factor loadings...
- 46
- 562
- 0
Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx
... substance and and Solid substance structurally bound water structurally bound water 40% 20% 40% intracellular intracellular water water extra-cellular extracellular water water Potential aqueous ... membranes of intracellular organelles (6) or are stored within the latter (7) In these cases, Vapp can exceed the actual size of the available fluid volume The significance of Vapp as a pharmacokinetic ... order to reach their sites of action, they must leave the bloodstream Drug permeation occurs largely in the capillary bed, where both surface area and time available for exchange are maximal (extensive...
- 10
- 475
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
- 14
- 635
- 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf
... in AD There are numerous pathological hallmarks in AD that are commonly accompanied by neuronal alterations These physical alterations include aberrant neurite sprouting and significant neuronal ... Regulation of metallothionein-III (GIF) mRNA in the brain of patients with Alzheimer disease is not impaired Mol Chem Neuropathol 32, 101–121 17 Sogawa CA, Asanuma M, Sogawa N, Miyazaki I, Nakanishi ... in AD One of the primary pathological hallmarks of AD is the formation of b-amyloid (Ab) plaques, composed primarily of Ab(1–40) and Ab(1–42) peptides, which associate to form abnormal extracellular...
- 9
- 664
- 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf
... the lack of a transmembrane region, i.e an inability to dramatically lower the Km, it cannot exert the same dramatic impact on FX activation When G372AFVIIa was bound to lipidated TF, FX activation ... kinetic parameters were calculated by global tting of binding data to a : model using the software Biaevaluation 4.1 supplied by the manufacturer (Biacore AB) N-terminal pegylation and carbamylation ... N-terminal pegylation of G37 2A- FVIIa and FVIIa (A) Pegylation of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDSPAGE At each time point, a 12 lL aliquot of the reaction mixture was removed,...
- 11
- 619
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was from ... 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of ... Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol Microbiol Res 152, 33–38 10 Takenaka, S., Asami,...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... N A A A A A A A A A A S S S S S S S S S S C C C C C C C C C C T T T T T T T T T T T T T T T T T T T T N N N N N N N N N N AthalianaB 159 PativumB 159 SoleraceaB 159 159 NtabacumB A. thalianaA...
- 8
- 494
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25