5optimal synthesis of a heat recovery network for effective power generation

... boundary and the boundary variables are treated as P0 / -S primal events The unit models describe both normal and failed behavior and depend on a wide variety of operating parameters and failure ... ET Al.: FAULT TREE SYNTHESIS FROM A DIRECTED GRAPH MODEL FOR A POWER DISTRIBUTION NETWORK Each of the mains, A( l), and transformers, T(i), are sized to carry the entire plant load The tie breaker, ... of asterisks are used in Fig Example of a negative feed forward loop (NFFL) which acts to place of hand drawn lines so that printers and typewriters correct disturbances to 116 can easily draw...

Ngày tải lên: 03/01/2014, 19:37

... grid arrangement is also best in the case of a VAWT for optimal power generation Wake, power and cost modeling of a HAWT 2.1 Jensen's wake modeling of a HAWT All the results reported to date in ... [4] of the wake and apply it to determine the wake of a VAWT Now, the cross-section area of the streamtube is a square of width 2R and height H instead of a circle From the conservation of momentum, ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...

Ngày tải lên: 05/09/2013, 17:03

... Centralize Management Delegate Administrative Delegate Administrative Control Control Lead-in As an administrator, you can take advantage of the Windows 2000 Active Directory and Group Policy features ... install software, you can ensure that the same applications are available on any computer to which a user logs on You can also ensure that missing files and settings are repaired automatically ... network are also represented as objects By representing all network resources as objects in a centralized database, Active Directory enables a single administrator to centrally manage and administer...

Ngày tải lên: 17/01/2014, 08:20

... Springer-Verlag, 3333: 418-425 14 Yen, J.C and J.I Guo, 2002 The design and realization of a chaotic neural signal security system Pattern Recognition and Image Analysis (Advances in Mathematical Theory and ... response and the actual response of the network produced by the input signal in accordance with an appropriate statistical criterion The training of the network is repeated for many examples in ... natural propensity for storing experiential knowledge and making it available for use The use of neural network offers the Input-Output Mapping property and capability[2,5-9] The ANNs learning algorithms...

Ngày tải lên: 14/02/2014, 16:20

... resonance Anal Biochem 305, 19 Wuerges J, Garau G, Geremia S, Fedosov SN, Petersen TE & Randaccio L (2006) Structural basis for mammalian vitamin B12 transport by transcobalamin Proc Natl Acad Sci USA ... Preparation of the unsaturated apo-form of IF was although modied Thus, the Cbl-saturated holo-IF (1 mgặmL)1) was dialysed against 20 volumes of m urea (30 C) instead of m GdnHCl The incubation ... Biodistribution of radiolabeled adenosylcobalamin in patients diagnosed with various malignancies Mayo Clin Proc 75, 568580 Bagnato JD, Eilers AL, Horton RA & Grissom CB (2004) Synthesis and characterization...

Ngày tải lên: 19/02/2014, 05:20

... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...

Ngày tải lên: 06/03/2014, 15:21

... obtained after baseline subtraction and data processing using the formulation of Privalov [32] Enzymatic activity tests The enzymatic activity of LamA before and after heat treatment was measured ... spectra of LamA after heat incubation at 150 °C were collected on samples which had been previously heated and then cooled to room temperature (heat incubation for 30 at 150 °C was performed in a ... temperature-controlled oil bath using thick-walled glass tubes with a lid capable of withstanding the vapour pressure of water) After subtraction of blank spectra, data analysis was performed...

Ngày tải lên: 07/03/2014, 05:20

Ngày tải lên: 15/03/2014, 23:56

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... carlsbergensis, no data available for E coli; b value for Lupinus luteus and bovine, no data available for E coli; c value for Paracoccus denitrificans, no data available for E coli d value for Bacillus subtilis, ... eukaryotic translation and its application in a wheat germ cell-free system Proc Natl Acad Sci USA 99, 9715–9720 15 Kigawa, T., Yabuki, T., Matsuda, N., Matsuda, T., Nakajima, R., Tanaka, A & ... data available for E coli; e no data available, assigned to group II based on side-chain rigidity; f no data available, assigned to group III based on similarity with Glu and Met 4086 K Ozawa...

Ngày tải lên: 16/03/2014, 18:20

... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase Preparation ... was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR kit (50 lL) The sequences underlined are ... was amplified on the pEU–scFvLH using SP6 primer (5¢-ATTTAGGTGACACTATAG-3¢) and anti-primer (5¢-ATGGCGCCAGCTGCAGGCTA-3¢, anti-stop codon in bold), and transcribed in the same way as above Translation...

Ngày tải lên: 16/03/2014, 23:20

... an international platform for Passivhaus actors with the European Passivhaus database The database will offer universal knowledge about Passivhaus standard and will support this sustainable and ... the database is to serve as an international acknowledged database for decision-makers of the European Commission and the European Parliament as well as all national and European bodies for implementing ... passivehousedatabase.eu an international (in first step European) internet based database shall be developed The targets are education, advertisement and quality assurance of Passivhaus standard,...

Ngày tải lên: 17/03/2014, 00:20

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 3020 P Prijatelj et al (Eur J Biochem 270) Vista, CA), digested with BamHI/HindIII (fragment 1, 60...

Ngày tải lên: 17/03/2014, 03:20

... immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 180°C for 12 ... 2006 J Am Chem Soc 128 5468 923 Kotsikau D, Ivanovskaya M, Orlik D and Falasconi M 2004 Sensor Actuat B101 199 Rumyantseva M et al 2006 Sensor Actuat B118 208 Sorescu M, Diamandescu L, Tarabasanu-Mihaila ... equal amounts of FeCl3 and NaOH concentrations at 180°C for 12 h Only FeOOH nanobelts formed, which means that the introduction of SnCl4 caused the formation of α-Fe2O3 instead of FeOOH We also...

Ngày tải lên: 19/03/2014, 16:48

... Sunkara, M K.; Vaddiraju, S [33] Morales, A M.; Lieber, C M A laser ablation method A method for the rapid synthesis of large ouantities of for the synthesis of crystalline semiconductor nanowires ... goethite and Amaratunga, G A J Growth and process conditions of natural hematite: Can Raman spectroscopy be used to aligned and patternable films of iron(III) oxide nanowires differentiate them? ... energy and can be attributed to OH or adsorbed oxygen [26] Thus, the XPS analysis confirmed the formation of a Fe2O3 phase Raman investigations of the cross-section part of the wire revealed the formation...

Ngày tải lên: 20/03/2014, 13:07

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... Brockett, and William B Dolan 2004 Monolingual machine translation for paraphrase generation In EMNLP, pages 142–149 Shiqi Zhao and Haifeng Wang 2010 Paraphrases and applications In COLING (Tutorials),...

Ngày tải lên: 23/03/2014, 14:20

... objective categories are potentially important for many text processing applications, such as information extraction and information retrieval, where the evidential status of information is important ... Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can be tagged with certainty Using only simple features, the classifier achieves ... of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic Computational Linguistics, 22(2):249-254 W Chafe 1986 Evidentiality...

Ngày tải lên: 23/03/2014, 19:20

... payments 20 Accounting for royalties payable – Recognition and valuation of assets and liabilities 23 Accounting for royalties payable – Stepped royalties 24 Accounting for royalties payable – Contingent ... an upfront payment for future royalties Royalties earned on the book’s sales are offset against the advance and only once the book generates more royalties than the value of the advance are additional ... the royalty advance asset would probably be “The assessment of an advance is dependent on accurate forecasting of sales” Issue: 4  MIAG  21  22  MIAG  Issue: Accounting for royalties payable Recognition...

Ngày tải lên: 29/03/2014, 20:20

... methods and analyzed with a microscope, BZ-8100 (Keyence, Osaka, Japan) Acknowledgements We greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions ... principle, because cadaverine is an amine substrate known to react with any active TGase Although aberrant TGase activity has been reported in several skin diseases, as a consequence of genetic mutation ... [25,26] Although several studies have focused on the localization, structural analysis and activation mechanism of TGase zymogen, not much information is available about the substrate specificity and...

Ngày tải lên: 29/03/2014, 21:20

... L .A. , Rivier, J.E & Vale, W.W (1999) Comparison of an agonist, urocortin, and an antagonist, astressin, as radioligands for characterization of corticotropin-releasing factor receptors J Pharmacol ... to SDS/PAGE Autoradiography was carried out on a BAS-IP NP 2040P imaging plate Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt) Gel documentation was accomplished ... difference was not statistically significant The photoactivatable antisauvagine-30 analog was shown to be as potent as its parent peptide when stimulating cAMP accumulation alone or suppressing agonist-induced...

Ngày tải lên: 31/03/2014, 08:20