... nucleic acids that can be analyzed We investigated these coupled parameters using MCF7 cells monolayers as a model system to establish operational parameters To obtain DNA that can be used for quantitative ... cells are to be sampled DNA quantification from local lysates was performed using quantitative PCR (qPCR) The NaOH lysates were first boiled for 10 min at 95 °C and then neutralized using 1:1 50 mM ... Med 17, 320–329 (2011) Yamada, K M & Cukierman, E Modeling Tissue Morphogenesis and Cancer in 3D Cell 130, 601–610 (2007) Gattazzo, F., Urciuolo, A & Bonaldo, P Extracellular matrix: A dynamic
Ngày tải lên: 04/12/2022, 16:34
... 4, 511–527, 2010 J Ettema et al.: Part 1: Evaluation (a) Observed Modeled 2m -1 T -2 -3 1975 (b) 1980 1985 1990 1995 Year 2000 -10 -20 -30 -40 Jan/1 Feb/1 Mar/1 Apr/1 May/1 Jun/1 Jul/1 Date Observed ... -1 2m -2 T 2005 -1 -3 (c) 10 Wind speed [m s ] anomaly [K] (a) o anomaly [K] 2 m temperature [ C] 518 1975 1980 1985 1990 1995 Year 2000 2005 Aug/1 Sep/1 Oct/1 Nov/1 Dec/1 Jan/1 20 15 10 anomaly ... anomaly [K] Jan/1 Feb/1 Mar/1 Apr/1 May/1 Jun/1 Jul/1 Date T 2m -1 -2 -3 -4 (d) Observed Modeled 1975 1980 1985 1990 1995 Year 2000 2005 T 2m anomaly [K] -1 -2 -3 1980 1985 1990 1995 Year 2000 2005
Ngày tải lên: 01/11/2022, 09:07
.VI SINHNG D NGDinh dư ng c a vi sinh v tYÊU C U DINH DƯ NG C A VI SINH V T 13.1.1. Thành potx
... 802 khoảng 1850 +Polysaccharide 350 000 (2) +Lipid 9,1 300 (3) +ADN 3,1 22 000 000 +ARN 20,5 2,1 khoảng 660 3,0 255 500 khoảng 350 - Các đơn phân tử +Aminoacid tiền thể 0,5 khoảng 100 +Đường ... 0,02-0,15 1,0-3,0 Acid pantoteic mg/kg 50-110 15-55 Inositol mg/kg 5000-8000 2500-6000 Tiamin mg/kg khoảng 1,3 khoảng 1,8 Tỷ lệ nguyên tố hợp chất cao phân tử vi sinh vật thấy rõ bảng sau đây: ... photphat không tan kết tủa môi trường nuôi cấy Điều tránh cách bổ sung thêm nhân tố có lực với kim loại (metal-chelating agents) EDTA (Ethylene Diamine Tetraacetic Acid) hay NTA (Nitrilotriacetic acid)
Ngày tải lên: 28/06/2014, 20:20
an integrated photoluminescence sensing platform using a single multi mode fiber coupler based probe
... bifurcated probe and the fluorescence detection area on the fluorescence intensity ratio ρ 0.122 0.21 0.120 0.18 0.118 0.15 0.116 0.12 0.114 0.09 0.112 0.06 0.110 0.108 0.03 0.106 0.00 0.104 ... the plastic cladding and placed in contact with each other The contact region was heated and fused; meanwhile, the assembly was elongated and tapered The input and out ends are identical; thus, ... Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Ave, Cambridge, MA 02139, USA; E-Mail: Zhuanna00@mails.thu.edu.cn School of Environment, Tsinghua University, No.1, Tsinghua Yuan, Haidian,
Ngày tải lên: 02/11/2022, 08:47
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx
... to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from ... skills and experience necessary to perform a task • Collect artifacts, such as printed documentation and manuals 50 Module 3: Using a Conceptual Design for Data Requirements Analyzing Information
Ngày tải lên: 10/12/2013, 17:15
Tài liệu Updating a Database Using a DataSet doc
... as a disconnected DataSet as it doesn't maintain an active connection to the database. Disconnected DataSet objects act as a data cache in applications. You can modify the data in the DataSet, ... time. Instead, a better approach is to connect to the database, fetch the data into a DataSet object, and then disconnect again. The user can browse the data in the DataSet and make any changes required. ... Updating a Database Using a DataSet In the exercises so far in this chapter, you have seen how to fetch data from a database. Now it's time to show you how to update data. First,
Ngày tải lên: 15/12/2013, 00:15
Tài liệu Web Programming Using a Simple Server ( http://thisisplc.blogspot.com) pdf
... are stored in a small wrapper class called Param Each pair holds one pair of the parameters class Param // A class that stores a name-value pair of parameters { private String name, value; Param ... complications involved with a full server Network Programming using the Java Programming Language The Java language has several classes that are used for network programming They are in the java.net ... processing program may read and write files on the server and access and modify a database 13 Accessing a Database from a Web Page The database we will initially use is that for an address book The following
Ngày tải lên: 22/12/2013, 17:15
Tài liệu STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING A PROJECT MANAGEMENT MATURITY MODEL ppt
... 9755.ch02 10/31/00 9:42 AM Page 13 13 Historical Basis External Analysis Internal Analysis Environmental Opportunities and Threats Gathering of Information Organizational Strengths and Weaknesses ... with Strategic Planning for Project Management 151 Introduction 151 The Many Faces of Success 152 The Many Faces of Failure 153 Training and Education 157 Change Management 158 Partnerships 162 Contents ... HealthCare, Inc. 185 Case 8: Clark Faucet Company 187 Case 9: Hyten Corporation 190 Case 10: Como Tool and Die (A) 200 Case 11: Como Tool and Die (B) 204 Case 12: Macon Inc. 207 Case 13: The
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Module 3: Using a Conceptual Design doc
... Data Storage Considerations Designing Data Services and Data Models Investigation Process Data Requirements Activity 3.1: Identifying Data-Related Use Cases and Data Requirements Module 3: Using ... that an actor must know to perform a function or task. Each functional data requirement is directly traceable to an actor and an object within a use case. Nonfunctional data requirements A ... solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from
Ngày tải lên: 24/01/2014, 10:20
Tài liệu Create a Point-and-Click Query Tool for Users Using a Web Form pptx
... OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and create a data table. Then set the ' data source of the data grid. odaDisplay = ... string is passed to a DataAdapter control, filling a data table. From there, the data is displayed when the data source of the DataGrid control is set to the data table. Users can change the ... to your ASP.NET application. When creating database applications, even on the Web, one of your clients inevitably wants to be able to examine the data in his database, and not necessarily in
Ngày tải lên: 26/01/2014, 11:20
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
... 98 203 110 213 26 188 106 211 196 249 156 12 21 177 245 246 peak max (°C) 103 213 113 225 60 205 110 225 47-74-113 206 257 50 164 45 59 183 256 257 peak area (J/g) 38 40 301 15 45 110 (total) 37 ... 99 189 110 213 106 213 238 242 104 210 255 258 peak max (°C) 92 186 107 201 111 222 117 202 113 226 111 226 249 252 109 224 36 266 22 266 peak area (J/g) 76 41 81 37 47 83 44 54 56 52 68 30 41 ... thermogravimetric analysis (TGA), attenuated total reflectance (ATR) IR and ATR-near-IR),12 methotrexate (along with TGA),13 carbamazepine (along with FTIR and hot-stage FTIR thermomicroscopy),14 ranitidine
Ngày tải lên: 14/02/2014, 03:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT 10451 10671 10438 10660 9057 9305 10482 10661 104 382 9903 10318 219 ... GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal ... pair 1G1P1 1G1P1 2G2P5 1G3P6 1G4P217 1G5P30 Primer sequence 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Do Firms Want to Borrow More? Testing Credit Constraints Using a Directed Lending Program doc
... Indian banking industry, Sankarnaranayan for his work collecting the data, Dean Yang and Niki Klonaris for excellent research assistance, and Robert Barro, Sugato Battacharya, Gary Becker, Shawn ... assistance, and Robert Barro, Sugato Battacharya, Gary Becker, Shawn Cole, Ehanan Helpman, Sendhil Mullainathan, Kevin Murphy, Raghuram Rajan and Christopher Udry for very useful comments. We are ... had started their relationship with the bank by 1996), 1997 data for 175 accounts (of 191 possible accounts), 1998 data for 217 accounts (of 238), and 1999 data for 213 accounts. In the winter
Ngày tải lên: 16/02/2014, 03:20
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
... 33:1911-1917 12 Brinster RL, Avarbock MR: Germline transmission of donor haplotype following spermatogonial transplantation Proc Natl Acad Sci USA 1994, 91:11303-11307 13 Clouthier DE, Avarbock ... was no regulation (NR) Transducer ME7413 had a surface area of ~ cm2 (5) while model ME7410 had a surface area of ~ 10 cm2 (10) Transducers were stationary (-) or were rotated in a plane parallel ... spermatogenesis in the rat Biol Reprod 1998, 59:1371-1377 15 Leoci R, Aiudi G, De Sandro Salvati A, Silvestre F, Binetti F, Lacalandra GM: Ultrasound as a mechanical method for male dog contraception
Ngày tải lên: 05/03/2014, 17:20
Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx
... year, a contract for nearly a half-million dollars was coded as Standard Industrial Classification [SIC]31 code 2111, or cigarettes The FSC code for this contract was J111, office building maintenance ... May/June 1990, pp 79–91 Rajagopal, Shan, and Kenneth N Bernard, “Strategic Procurement and Competitive Advantage,” International Journal of Purchasing and Materials Management, Fall 1993 - 89 - Sawchuk, ... impaired capability awaiting parts (MICAP), and backorder data, to contracts Another data challenge is that specific contracts for particular items from 26 individual contractors cannot easily
Ngày tải lên: 06/03/2014, 16:20
A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable Livelihoods Approach potx
... Post-Harvest Fisheries Research Programme PLA Participatory Learning and Action PPA Participatory Poverty Assessment PRA Participatory Rural Appraisal RMA Rapid Market Appraisal RRA Rapid Rural Appraisal ... Financial Capital Assets Technical Post-harvest Issues The Way Forward 13 13 14 14 14 17 18 18 Practical Issues Steps Involved in the Case Study Projects Review of methods used in the Bangladesh ... chain, for example, are fishers and/or villagers aware of prices in the main fish markets (i.e the regional or national markets, i.e Dhaka, Chittagong, Cox’s Bazaar and Khulna)? G Are there barriers
Ngày tải lên: 07/03/2014, 00:20
Studying Aesthetics in Photographic Images Using a Computational Approach pot
... Modeling Approach, ” IEEE Trans on Pattern Analysis and Machine Intelli., 25(9):1075–1088, 2003 13 W Y Ma and B S Manjunath, “NeTra: A Toolbox for Navigating Large Image Databases,” Multimedia Systems,... ... Studying Aesthetics in Photographic Images Using a Computational Approach Ritendra Datta Dhiraj Joshi Jia Li James Z. Wang The Pennsylvania State University, University Park, PA 16802, USA Abstract. ... Gupta, and R Jain, “Content-Based Image Retrieval at the End of the Early Years,” IEEE Trans on Pattern Analysis and Machine Intelli., 22(12):1349–1380, 2000 19 T M Therneau and E J Atkinson, “An
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx
... simplification and lexical expansion. Information processing and management, 43(6):1606–1618. R.S. Varga. 1962. Matrix Iterative Methods. Prentice- Hall. G. A. Vignaux and Z. Michalewicz. 1991. A ge- netic ... commercial summa- 10 The regular expressions specifying “word” were adapted to Hebrew alphabet. The same toolkit was used for sum- maries evaluation on Hebrew corpus. 11 Dataset is available at ... Edmundson. 1969. New methods in automatic extracting. ACM, 16(2). G. Erkan and D. R. Radev. 2004. Lexrank: Graph- based lexical centrality as salience in text summa- rization. Journal of Artificial Intelligence
Ngày tải lên: 07/03/2014, 22:20
ASSISTED REPRODUCTIVE TECHNOLOGIES: OVERVIEW AND PERSPECTIVE USING A REPRODUCTIVE JUSTICE FRAMEWORK pdf
... Arons, J Arkansas, Hawaii, Maryland, Rhode Island, and Texas Arons, J Arkansas, Hawaii, Maryland, Texas 14 The Ethics Committee of the American Society for Reproductive Medicine (2006) Access to ... statistics (latest available) can be found at http://www.cdc.gov/MMWR/preview/mmwrhtml/ss5606a1.htm Alternative Insemination (AI) (also known as Artificial Insemination) AI refers to several ... document: Sujatha Jesudason, for substantial assistance in framing; Patricia Berne, Jamie Brooks, and Marcy Darnovsky for critical feedback on an early draft; Jessica Arons, Terry Boggis, Maggie Crosby,
Ngày tải lên: 14/03/2014, 16:20
Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt
... and R2 F45 S46 V42 A43 L35 A26 I41 E44 E16 G22 A130 S134 F135 E131 C174 A71 S21 R19 T128 A28 T56 R62 A55 A57 M53 S54 E33 G51 E39 G92 L37 S7 V6 V61 G59 L125 E49 L122 K85 M73 Y114 E72 E102 V74 G75 C4 E103 N124 W91 V93 K99 G100 W105 F86 T76 A84 T80 Y173 H170 G172 Q149 F77 C120 F137 L144 R166 R163 I106 Y165 A115 V69 E158 R153 K58 K17 Q156 Y118 K30 S132 K89 M88 T78 N101 K87 Q98 Q117 E68 K29 N40 N171 W24 V136 G127 Y90 H104 S119 Q38 R121 Y133 R60 M27 I168 R5 Y25 S138 T113 R10 R155 E140 E112 V107 V116 E108 K12 T109 N14 R139 Y111 R2 Q98 E102 N101 I106 C4 A115 Y114 Y90 K85 N124 V69 M73 A71 G75 E82 F77 S119 L125 G59 E158 N171 Q164 G172 Q149 Y173 R153 L144 T128 C129 F135 S134 V136 E140 F137 N66 C174 M27 E16 K17 E13 F36 S7 R19 E33 V6 E31 Y25 W24 S21 G22 Q38 E39 M53 S54 A55 A57 S46 F45 E44 V42 A43 T56 K58 K87 E68 V61 N40 K29 R60 R121 Y165 Q117 Y133 R166 K30 W105 S138 G127 E131 Y118 L122 A130 R163 S132 T113 R5 R139 R10 Y111 R155 V107 N14 V116 E108 T109 K12 A B Fig. ... and R2 F45 S46 V42 A43 L35 A26 I41 E44 E16 G22 A130 S134 F135 E131 C174 A71 S21 R19 T128 A28 T56 R62 A55 A57 M53 S54 E33 G51 E39 G92 L37 S7 V6 V61 G59 L125 E49 L122 K85 M73 Y114 E72 E102 V74 G75 C4 E103 N124 W91 V93 K99 G100 W105 F86 T76 A84 T80 Y173 H170 G172 Q149 F77 C120 F137 L144 R166 R163 I106 Y165 A115 V69 E158 R153 K58 K17 Q156 Y118 K30 S132 K89 M88 T78 N101 K87 Q98 Q117 E68 K29 N40 N171 W24 V136 G127 Y90 H104 S119 Q38 R121 Y133 R60 M27 I168 R5 Y25 S138 T113 R10 R155 E140 E112 V107 V116 E108 K12 T109 N14 R139 Y111 R2 Q98 E102 N101 I106 C4 A115 Y114 Y90 K85 N124 V69 M73 A71 G75 E82 F77 S119 L125 G59 E158 N171 Q164 G172 Q149 Y173 R153 L144 T128 C129 F135 S134 V136 E140 F137 N66 C174 M27 E16 K17 E13 F36 S7 R19 E33 V6 E31 Y25 W24 S21 G22 Q38 E39 M53 S54 A55 A57 S46 F45 E44 V42 A43 T56 K58 K87 E68 V61 N40 K29 R60 R121 Y165 Q117 Y133 R166 K30 W105 S138 G127 E131 Y118 L122 A130 R163 S132 T113 R5 R139 R10 Y111 R155 V107 N14 V116 E108 T109 K12 A B Fig. ... and R2 F45 S46 V42 A43 L35 A26 I41 E44 E16 G22 A130 S134 F135 E131 C174 A71 S21 R19 T128 A28 T56 R62 A55 A57 M53 S54 E33 G51 E39 G92 L37 S7 V6 V61 G59 L125 E49 L122 K85 M73 Y114 E72 E102 V74 G75 C4 E103 N124 W91 V93 K99 G100 W105 F86 T76 A84 T80 Y173 H170 G172 Q149 F77 C120 F137 L144 R166 R163 I106 Y165 A115 V69 E158 R153 K58 K17 Q156 Y118 K30 S132 K89 M88 T78 N101 K87 Q98 Q117 E68 K29 N40 N171 W24 V136 G127 Y90 H104 S119 Q38 R121 Y133 R60 M27 I168 R5 Y25 S138 T113 R10 R155 E140 E112 V107 V116 E108 K12 T109 N14 R139 Y111 R2 Q98 E102 N101 I106 C4 A115 Y114 Y90 K85 N124 V69 M73 A71 G75 E82 F77 S119 L125 G59 E158 N171 Q164 G172 Q149 Y173 R153 L144 T128 C129 F135 S134 V136 E140 F137 N66 C174 M27 E16 K17 E13 F36 S7 R19 E33 V6 E31 Y25 W24 S21 G22 Q38 E39 M53 S54 A55 A57 S46 F45 E44 V42 A43 T56 K58 K87 E68 V61 N40 K29 R60 R121 Y165 Q117 Y133 R166 K30 W105 S138 G127 E131 Y118 L122 A130 R163 S132 T113 R5 R139 R10 Y111 R155 V107 N14 V116 E108 T109 K12 A B Fig.
Ngày tải lên: 16/03/2014, 23:20