... 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page 5 of 9 RESEARC H Open Access On the maximum modulus of a polynomial and its polar derivative Ahmad Zireh Correspondence: azireh@shahroodut.ac.ir Department ... of a theorem of Paul Turan concerning polynomials. Math Ineq Appl. 1, 231–238 (1998) 7. Jain, VK: Generalization of an inequality involving maximum moduli of a polynomial and its polar derivative. ... J Approx Theory. 54 , 306– 313 (1988). doi:10.1016/ 0021-90 45( 88)90006-8 5. Shah, WM: A generalization of a theorem of Paul Turan. J Ramanujan Math Soc. 1,67–72 (1996) 6. Aziz, A, Rather, NA: A...
Ngày tải lên: 20/06/2014, 22:20
... phần đ a chỉ sau khi đã hoàn thành nên nằm dưới một chút đường ở gi a phong bì thư và cách đều hai lề trái, phải. Bài 1 - The parts of a letter (Thành phần c a một bức thư)-phần2 5. THE ... Nguyen Thanh Hoa thì bạn không nên gửi thư cho một người rồi ký tên là "Hoa" sau đó trong bức thư gửi đến một người khác lại ký là "Thanh Hoa" hay "Nguyen Thanh Hoa". ... tiết kiệm thời gian triệt để và giúp bức thư thương mại nhìn sạch sẽ, sáng s a hơn. Ví dụ: Hall, Haines & Company (được đánh máy sẵn) Trieu Phong (viết tay) Cashier (được...
Ngày tải lên: 12/07/2014, 01:20
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx
... hai hay nhiều người cộng Bài 1 - The parts of a letter (Thành phần c a một bức thư)-phần3 Note (Lưu ý): Trong thư riêng tư, thân mật chúng ta sẽ sử dụng dấu phẩy đằng sau "Dear" ... dấu hai chấm. Còn nếu theo văn phong Anh Anh các bạn hãy bỏ trống, không sử dụng dấu câu. Ví dụ: Dear Mr. ThanhPhong: Dear Mr ThanhPhong Mà hãy dùng "The National Cash Register ... Giáo sư Dear Mai Anh, Tuy nhiên, trong thư thương mại, trao đổi công việc các bạn không nên sử dụng dấu phẩy đằng sau "Dear". Thay vào đó, nếu theo văn phong Anh Mỹ các bạn...
Ngày tải lên: 12/07/2014, 01:20
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf
Ngày tải lên: 12/07/2014, 01:20
A comparison on cohesive devices between the gift of the magi and its two vietnamese translation versions
Ngày tải lên: 14/12/2013, 00:40
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...
Ngày tải lên: 17/03/2014, 01:20
a brief history of led zeppeln and its musical impact
... impression of their music is obvious, and can be heard in any Rock band of today.Unfortunately, the machine that was Led Zeppelin came to a screeching halt on the morning of September 25, 1980. When band ... months of their official debut, Led Zeppelin were at the top of the bill at the Playhouse Theater in London, and the Pop Proms at the Royal Albert Hall in London. On October 17, '69, a year and two ... go into Bonham's bedroom to pull a prank on him in his sleep, Bonham was found dead. After a night of heavy drinking, Bonham had turned the wrong way in his sleep, and asphyxiated himself...
Ngày tải lên: 21/03/2014, 21:54
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf
... Warfare, Santa Monica, Calif.: RAND Corporation, MG-191 -A, 20 05. Hoge, C., et al., “Combat Duty in Iraq and Afghanistan, Mental Health Problems, and Barriers to Care,” New England Journal of Medicine, ... SECURITY POPULATION AND AGING PUBLIC SAFETY SCIENCE AND TECHNOLOGY SUBSTANCE ABUSE TERRORISM AND HOMELAND SECURITY TRANSPORTATION AND INFRASTRUCTURE WORKFORCE AND WORKPLACE The RAND Corporation is a nonprofit ... variables actually increase the effect of stress on individual functioning. Research by Green et al. (1990) and Kahana, Harel, and Kahana (1988) suggests that individuals in each of the above-mentioned...
Ngày tải lên: 29/03/2014, 18:20
báo cáo hóa học:" The impact of iron overload and its treatment on quality of life: results from a literature review" pptx
... G, Alberti D, Thalassarmia ICG: Pharmaco- surveillance and quality of care of thalassaemic patients. A large scale epidemiological survey. European Journal of Clinical Pharmacology 2001, 56 :9 15- 922. 29. ... K, Arana A, Wait S, Elefth- eriou A: Impact of thalassemia major on patients and their families. Acta Haematologica 2002, 107: 150 - 157 . 4. Rebulla P: Transfusion reac tions in thalassemia. A survey from ... 180 Park Avenue, Bldg. 1 05, Florham Park, NJ 07932-06 75, USA Email: Linda Abetz* - linda.abetz@mapivalues.com; Jean-Francois Baladi - jeanfrancois.baladi@novartis.com; Paula Jones - paula.jones@novartis.com;...
Ngày tải lên: 20/06/2014, 16:20
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... CCATGTAGGCGGTGACGA simA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2 PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC ... TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4 simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG ... simReg1 SSR1R TTTGAATTCATTAATGGTGATGGT purification SR1D4F TAGAATTCGTGAGCAGATCATGT DNA-shift assay P D4 SR1D4R TAGAATTCCATTGTGAACCATC SD2R1F TAGAATTCATCGCCACGACCATG DNA-shift assay P R1 SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx
... inequalities,” Journal of Mathematical Analysis and Applications, vol. 3 35, no. 2, pp. 1294–1308, 2007. 18 A. W. Marshall and I. Olkin, Inequalities: Theory of Majorization and Its Applications, ... eigenvalues of a linear transformation,” Proceedings of the National Academy of Sciences of the United States of America, vol. 35, pp. 408–411, 1949. Journal of Inequalities and Applications ... functions,” Linear Algebra and Its Applications, vol. 369, pp. 217–233, 2003. 5 K. Guan, “The Hamy symmetric function and its generalization,” Mathematical Inequalities & Applications, vol....
Ngày tải lên: 22/06/2014, 02:20
Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt
... pages doi:10.1 155 /2007 /58 416 Research Article On a Class of Parametric Transforms and Its Application to Image Compression Susanna Minasyan, 1 Jaakko Astola, 1 and David Guevorkian 2 1 Institute of Signal Processing, ... [22 ]and later also in [23]). Similarly, a family of Hadamard-like trans- forms and a family of slant-like transforms have been intro- duced in [22, 23]. The general goal of this paper is to analyze ... also automatic gen- eration of transform parameters meaning that the transform may automatically be adapted to the input signal or image. 6. CONCLUSION A new class of parametric transforms was...
Ngày tải lên: 22/06/2014, 20:20
Báo cáo vật lý: "A Perspective of Oil Palm and Its Wastes" doc
Ngày tải lên: 07/08/2014, 14:20
Báo cáo khoa học: "A critical review of larch hybridization and its incidence on breeding strategies" potx
Ngày tải lên: 09/08/2014, 02:21
báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc
Ngày tải lên: 12/08/2014, 03:20