5 a invocation of conditions

... fluorescence analysis, elements having molecular weights not smaller than that of Na can be easily analyzed qualitatively and quantitatively; the method is very suitable for elemental analysis of inorganic ... with an English abstract) 11) Toda K (1996) X-ray fluorescence analysis In: Izumi Y, Ogawa M, Kato S et al (eds) Manual of Instrumental Analysis, 2nd edn., vol Kagakudojin, Kyoto, pp 55 –72 (in Japanese) ... plates coated by stationary phases with small and uniform particles (4 .5 5 µm diameter) have became commercially available [6]; these plates are superior in separation ability and requires shorter...

Ngày tải lên: 22/01/2014, 00:20

... 2: Grammar II, sentence set II Strategy TD TDo LC LC¢ LCK LCK LCKt LCK,t Active Inactive Total Time Rank 50 15 3 258 7232 3237 6 154 1283 2719 9 15 26 75 26 75 554 7 26 75 554 7 55 47 26 75 26 75 7690 59 33 ... recursion worse than Earley's algorithm, illustrates this: Assume a grammar with rules S * Ae, A * aA, A -* b and a sentence aa a a a b c" to be parsed Here a bottom-up parser such as Kilbury's ... Context-free Parsing Algorithm For Natural Languages Proc 9th IJCAI, Los Angeles, California: 756 =764 Tomita, Masaru (1986) E~cient Parsing for Natural Language A Fast Algorithm for Practical Systems...

Ngày tải lên: 09/03/2014, 01:20

... (5 -GTAATACGACTCA CTATAGGGTACCATGCTTTTAATAGAAG-3¢) and 2 054 (5 -GATCCATGGTCATATGTTAATTTTTTTAA AG-3¢); )36-RNA (wild-type sequence of the psbA mRNA corresponding to positions )36 to +13 relative ... the AUG); T7–36ntA5¢ (5 -GTAATACGACTCACTATAGG GTTTACGGAGAAATTAAAAC-3¢) and 2 054 ; M1RNA (sequence of the psbA mRNA corresponding to positions )36 to +13 relative to the AUG with an exchange at ... C residues); psbA-T7mut1 (5 -GT AATACGACTCACTATAGGGTTTACGGAGCCCCC CCCCC-3¢) and psbA3¢mut1 (5 -GATCCATGGTCATAT GTTAATTTTTTTAAAGGGGGGGGGGC-3¢); M2RNA (sequence of the psbA mRNA corresponding to...

Ngày tải lên: 17/03/2014, 11:20

... and intrarenal vascular tissue decreasing glomerular filtration rates [29], stimulation of apoptosis of immature thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders ... F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, Y & Narumiya, S (1993) Thromboxane A2 receptor is highly expressed in mouse immature thymocytes and mediates DNA fragmentation ... Kinase reporter vectors and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation, Madison, WI, USA Taq DNA polymerase, T4 DNA ligase and calf intestinal alkaline phosphatase...

Ngày tải lên: 31/03/2014, 09:20

... You always heard about his appearances at the Grand Galloping Gala every year Was Rarity and this Prince an item at some point? “And just what are YOU looking at?” Rarity asks, her face now a scowl ... mouth and allowing you to be the explorer for a change The pleasure you feel as you lap at every last corner and taste as much of her as you can is almost unreal If there was a heaven, you can't ... does not‟ mean you are at ALL presentable Understand?” You just nod “I I need an interview?” Rarity shakes her head “Let‟s call you an apprentice Or an aide.” The aide of Rarity You have a job working...

Ngày tải lên: 23/05/2014, 14:08

... health status and health-related quality of life in a cohort Page 10 of 11 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 of Italian children following treatment for a primary brain ... Canada Daria O’Reilly and Jean-Eric Tarride each hold a 2007 Career Scientist Award, Ontario Ministry of Health and Long-Term Care Author details Programs for Assessment of Technology in Health ... than 77, as some studies evaluated multiple conditions and/or used multiple methods of utility measurement separately for cohorts of patients with a mean age of years and a mean age of 38 years...

Ngày tải lên: 18/06/2014, 19:20

... 20(1):41 -54 Blumenthal JA, Babyak MA, Moore KA, Craighead WE, Herman S, Khatri P, Waugh R, Napolitano MA, Forman LM, Appelbaum M, Doraiswamy PM, Krishnan KR: Effects of exercise training on older patients ... in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed proposal for ... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased...

Ngày tải lên: 18/06/2014, 22:20

... 78363-8202, USA *Corresponding author: manuel.delasen@ehu.es Email address: RPA: Agarwal@tamuk.edu Abstract This article discusses three weak φ-contractive conditions of rational type for a class of 2cyclic ... results for a class of extended cyclic self-mappings under three general weak contractive conditions of rational type Manuel De la Sen*1 and Ravi P Agarwal2 Instituto de Investigacion y Desarrollo ... version of the manuscript References [1] Harjani, J, Lopez, B, Sadarangani, B: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space...

Ngày tải lên: 18/06/2014, 22:20

... elliptic equations, diagonal systems and variational integrals Manuscripta Math 55 , 467–486 (1986) doi:10.1007/BF01186 659 Rutkauskas, S: On the first boundary value problem for the class of elliptic ... systems degenerating at an inner point Math Model Anal 6(1), 147– 155 (2001) Rutkauskas, S: On the Dirichlet problem for a system of degenerate at a point elliptic equations in the class of bounded ... (Russian) Achildiyev, SA: First and second boundary value problems for elliptic equations degenerating at the inner points of finite number Dokl Akad Nauk SSSR 152 (1), 13–16 (1963) (Russian) Yanushauskas,...

Ngày tải lên: 21/06/2014, 00:20

... JK: An energy estimate for the biharmonic equation and its application to Saint-Venant’s principle in plane elastostatics Indian J Pure Appl Math 14, 791–8 05 (1983) Tahamtani and Peyravi Boundary ... semilinear elliptic and parabolic equations Demonstratio Mathematica 31, 43 54 (1998) Flavin, JN: On Knowles’version of Saint-Venant’s principle in two-dimensional elastostatics Arch Ration Mech Anal ... 20 Haraux, A: Series lacunaires et controle semi-interene des vibrations d’une plaque rectangulaire J Math Pures App 68, 457 –4 65 (1989) 21 Celebi, AO, Kalantarov, VK: Spatial behaviour estimates...

Ngày tải lên: 21/06/2014, 00:20

... accretive mappings in Banach spaces, J Math Anal Appl 194 (19 95) , no 1, 114–1 25 J G O’Hara, P Pillay, and H.-K Xu, Iterative approaches to finding nearest common fixed points of nonexpansive mappings ... resolvents of accretive operators in Banach spaces, J Math Anal Appl 75 (1980), no 1, 287–292 , Approximating fixed points of nonexpansive mappings, Panamer Math J (1994), no 2, 23–28 T Shimizu and W Takahashi, ... nonexpansive mappings in Banach spaces, Proc Amer Math Soc 1 25 (1997), no 12, 3641–36 45 R Wittmann, Approximation of fixed points of nonexpansive mappings, Arch Math (Basel) 58 (1992), no 5, 486–491...

Ngày tải lên: 23/06/2014, 00:20

... Normal University, Lanzhou 730070, China E-mail address: mary@maths.uq.edu.au Yulian An: Physical Software & Engineering, Lanzhou Jiaotong University, Lanzhou 730070, Gansu, China E-mail address: ... 22 75 2283 J Y Wang and J Jiang, The existence of positive solutions to a singular nonlinear boundary value problem, J Math Anal Appl 176 (1993), no 2, 322–329 Ruyun Ma: Department of Mathematics, ... Multiplicity of positive solutions for a nonlinear differential equation with nonlinear boundary conditions, Ann Polon Math 69 (1998), no 2, 155 –1 65 L Erbe and M Tang, Structure of positive radial solutions...

Ngày tải lên: 23/06/2014, 00:20

... in another special issue [12] A third conference was in Japan in September 2004 A summary of a large amount of experimental data on gigacycle fatigue as well as a description of the test apparatus ... test to another and appears in the resultant database as the constant under which the test was conducted It was probably this type of thinking and the number of available parameters that led the ... fatigue behavior The data obtained at 20 kHz are also compared with 60 Hz data obtained on a conventional test machine and again show no difference In this figure, the data at both frequencies at cycle...

Ngày tải lên: 03/07/2014, 20:20

... 0. 454 5e1, c = 0. 453 5e1 then (b – c) = 0.0010e1 = 0.1000e – l a( b – c) = (0 .55 55e1) × (0.1000e – 1) = (0. 055 5e0) = 0 .55 50e – ab = (0 .55 55e1) × (0. 454 5e1) = 0. 252 4e2 ac = (0 .55 55e1) × (0. 453 5e1) ... the normalized floating-point representation the associative and the distributive laws of arithmetic are not always valid The example given below proves the above statement: Let a = 0 .55 55e1, b ... Here mantissas are added because exponent numbers are equal That is, 0. 454 6e5 + 0 .54 33e5 = 0.9979e5 Example 11 Subtract the floating-point number 0 .54 24e3 from 0 .54 52e3 Sol While subtracting 0 .54 24e3...

Ngày tải lên: 04/07/2014, 15:20

... die of the latter than the former." "Nature meant me," he said, "for a hazy man I have all the qualifications for a first-class idler And circumstances and the misfortune of my opinions are going ... Is it true, what they tell me, that many of the factories in Medchester are closed, and many of those that are open are only working half and three-quarter time?" "I am afraid that it is quite ... Nevertheless, you shall have them No one has ever called me selfish Let us have tea, and toast, and bread-and-butter and cakes, and a great many muffins, please, young lady," he ordered "And will you send...

Ngày tải lên: 06/07/2014, 02:20

... earns a little He can't it in a dignified manner, and with cleanliness and health That is what he has a right to That is what the next generation will demand He should have room to expand Cleanliness, ... cheated, and deceived at first I fancy that after a time that will wear itself out." "It is a fascinating idea," she said, thoughtfully, "but to carry it out in any way thoroughly you want a great many ... have to pay a small salary." "I could come in the afternoons," she said "Capital! But are you sure," he said, after a moment's hesitation, "that it is quite fair to yourself? "Oh, I can manage...

Ngày tải lên: 06/07/2014, 05:20

... last week I am a salaried official of the Society from last Monday." Sybil stole a swift side-glance at her "Do you know, I think that it must be a very satisfactory sort of life," she said Mary's ... here What fun we should have had." "Oh, these Etrusians," Lord Arranmore murmured "I thought that a bishop was very near heaven indeed, all sanctity and charity, and that a bishop's wife was the ... bishop's wife said stiffly, "of a man who adopted such principles as that And although I not as a rule approve of Mr Lavilette or his paper, I am seriously inclined to agree with him in some of his strictures...

Ngày tải lên: 06/07/2014, 05:20