... risk that mere chance affects the estimates The effect evaluation data was however analysed in a longitudinal analysis, that seeks to take account of both within-area, between-area and population-group ... are altered in univariate and multivariate analyses based on alternative data sources (details are found in [18]) The overall model uncertainty is investigated in a bootstrap analysis based on the ... fracture Death risks Health care costs Community care Pharmaceuticals Informal care QoL reduction from hip fracture Average QoL annual cost annual cost annual cost annual cost annual men 65–69 y men...
Ngày tải lên: 13/08/2014, 11:22
... the costs of the two wards Daily costs per patient were calculated based on the annual cost and the number of beds, assuming an occupancy rate of 100% In fact, a large part of the total cost of ... questionnaire [1] In each hospital, the cost- block questionnaire was completed by the participating ICU and by one surgical and one medical ward The annual ward cost was defined as the average of the ... not accepted and treated on the ward For patients accepted to ICU, the total cost was defined as the cost of the ICU stay, plus the ward stay cost after ICU discharge The daily cost per patient...
Ngày tải lên: 14/08/2014, 07:21
technical assistance in bridging the “digital divide” - a cost benefit analysis for broadband connectivity in europe - pwc_final_report
... countries have good broadband availability in urban areas, but face a challenge in rural areas The assumed availability by access speed for residential and SoHo users in urban and rural areas is shown ... 650 Base case - annual cost (euro) per user 3.5 Average cost per user To undertake the cost benefit analysis for the study required an average cost per user for the urban and rural areas of each ... operators have substantial capacity available at Ku-band and to a much lesser extent at C-band In addition, the major operators are incrementally introducing new capacity at Ka-band, specifically intended...
Ngày tải lên: 21/08/2014, 15:25
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc
... Statistical analysis The organization and the exon-intron boundaries of the human thromboxane (TX) A2 receptor (TP) gene and the theoretical range of putative TP mRNA transcripts are 4062 A T Coyle ... found to lack typical TATA or CAAT boxes (Fig 8), similar to that Ó FEBS 2002 Analysis of the TPa and TPb mRNAs (Eur J Biochem 269) 4067 Fig Functional analysis of the 5¢ flanking region of the TP ... used as a positive control Following PCR analysis Ó FEBS 2002 Analysis of the TPa and TPb mRNAs (Eur J Biochem 269) 4065 Fig Analysis of the differential 5¢ UTR utilization of the TP mRNA transcripts...
Ngày tải lên: 31/03/2014, 09:20
báo cáo sinh học:" Using nurses to identify HAART eligible patients in the Republic of Mozambique: results of a time series analysis" potx
... this analysis Cox proportional hazards regression was then used to compare the hazard rates at which these patients started HAART before and after the intervention, using the date of the initial ... on HAART each month (count variable), compared before and after the intervention We first evaluated the bivariate associations between the average number of patients starting HAART per month and ... staff after the data analysis was completed revealed that the complete implementation of the intervention was delayed in Chimoio due to the absence of a key clinic advisor This delay may explain...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf
... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’-untranslated region of GS 1a was obtained by cleavage with ... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative ... facilities of the Molecular Biology Laboratory, Research Services, Universidad de Málaga The nucleotide sequence data reported are available in the EMBL, GenBank and DDBJ Nucleotide Sequence Database...
Ngày tải lên: 08/08/2014, 14:20
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...
Ngày tải lên: 06/03/2014, 15:21
A Cost-Benefit Analysis of the National Guard Youth ChalleNGe Program pot
... missing earnings data in any given survey year The average age of the sample at the time of their last completed survey wave is 47 24 A Cost- Benefit Analysis of the National Guard Youth ChalleNGe ... We measure educational attainment at age 20, since the ChalleNGe program evaluation results at 36 months, on average, are applicable to admittees of that age The assumption of the model, then, ... Table 4.4 Estimated Effect of Educational Attainment at Age 20 on the PDV of Cash Transfers Educational Attainment at Age 20 GED Estimated Effect of Educational Attainment on PDV of Cash Transfers...
Ngày tải lên: 30/03/2014, 05:20
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx
... 2.1 Characteristics of Image Analysis Algorithms Image analysis consists of extracting some relevant parameters from one or several images Image analysis examples are object segmentation, feature ... being adapted to the speed and flow of data 2.2 An Adaptable Structure for Image Analysis Algorithms The architecture presented here is designed from the characteristics of image analysis applications ... The data structure is dynamic in order to adapt to different types of data The length of packet and data, number and size of flits, and the depth of VC are all parameterized The size of flits can...
Ngày tải lên: 21/06/2014, 20:20
báo cáo khoa học:" Applied mechanics of the Puricelli osteotomy: a linear elastic analysis with the finite element method" doc
... that, in vivo, a larger and more adjusted medullary bone surface of contact among bone fragments and a decrease in size of lever arm are obtained These results also suggest greater stability of ... resistance arm of the mandible, seen as an interpotent lever of the third gender Currently, many of the models investigated by engineers and researchers in the area of solids mechanics are approached ... long axis, 13 mm from the mandibular incisure, another was parallel to the external oblique line, mm lingual to it, and the third cut was 23 mm proximal to the distal border of the mental foramen,...
Ngày tải lên: 12/08/2014, 00:20
Báo cáo y học: " Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae" ppsx
... scale using a scale factor equal to the median value of the ratio of each element to a common standard This scale factor can then be used to normalize the mutant data in the same experiment The ... is then calculated in a similar way, with scale factors for each replicate, wiko , calculated The following additional data are available with the online version of this paper Additional data ... of analysis will also aid in our understanding of how plant and animal cells control these processes at the cellular and perhaps even organismal levels Materials and methods Yeast strains analyzed...
Ngày tải lên: 14/08/2014, 14:22
Báo cáo y học: " Feature-level exploration of a published Affymetrix GeneChip control dataset" pptx
... of triplicates from the Affymetrix HGU13 3A spike-in experiment [2,3] we calculated the average log ratio across the three comparisons (M) and the average log intensity (A) across all six arrays ... KF: Evaluation of methods for oligonucleotide array data via quantitative real-time PCR BMC Bioinformatics 2006, 7:23 11 GeneChip Expression Analysis: data analysis fundamentals [http://www.affymetrix.com/support/ ... algorithms, and the Choe et al [1] data may be useful for the development of these new methods Additional data files Additional data file contains MA plots for 100 randomly chosen pairs of Genome...
Ngày tải lên: 14/08/2014, 17:22
Exploration of a framework for behavior based malware detection and classification
... shares is also another vector These are all attack vectors that most research cannot guard against Our behavioral approach concentrates on dynamically looking for behaviors that indicate malwares ... exploits We take advantage of the fact that while malwares can have many attack vectors, they have a limited number of actions that enables them to successfully replicate and perform their nefarious ... the same family and across different families 4.1 Malware Propagation Share and Trends In any behavioral studies, it is important to have a large sample population But as the number of available...
Ngày tải lên: 05/10/2015, 22:15
báo cáo sinh học:" A cost-effectiveness study of caesarean-section deliveries by clinical officers, general practitioners and obstetricians in Burkina Faso" doc
... caesarean sections are associated with the management of cases by health teams at hospital level, which may not always be the case Finally our operational approach to assess the comparability of cases ... Moctar Ouedraogo, Peter Byass and Danielle Belemsaga for assistance with data management and analysis; and Issiaka Sombie for valuable comments on the report of the evaluation The funder and ... increase in salary and no clear career path) Costing caesarean sections by type of provider Table shows the annual training and deployment costs of providers The annual training cost of an obstetrician...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: A cost effectiveness study" pdf
... [13,14] The therapeutic approach for symptoms of schizophrenia is mainly based around pharmaceutical treatment Atypical antipsychotics could offer particular advantages over typical antipsychotics and ... psychiatric beds in Greece, the representation of all types of public mental healthcare providers and the academic status of the experts and/or their managerial position in the relevant units The analysis ... €2.42 per stable day in the case of -10% of the duration of relapses), even in the event of a 10% decrease of the frequency and duration of relapses (Table 12) Another set of parameters tested...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: a cost effectiveness study" ppsx
... Annals of General Psychiatry 2009, 8:15 http://www.annals-general-psychiatry.com/content/8/1/15 Table 1: Mean annual number of stable days and cost per patient by pharmaceutical treatment Paliperidone ... Ollandezos M, Athanasakis K, Papanicolaou S, Kyriopoulos I: Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia ... significant development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Setting priorities for the health care sector in Zimbabwe using cost-effectiveness analysis and estimates of the burden of disease" pot
... analysis of the data and drafted the manuscript GC contributed substantially to the conception and design of the study, data collection in the field, analysis of the data and critically reviewed the ... Williams A: Calculating the global burden of disease: time for a strategic reappraisal? Health Econ 1999, 8:1-8 Kumaranayake L, Walker D: Cost- effectiveness analysis and priority-setting: global approach ... an alternative assumption or parameter were compared to the rank order of Table their ranks by more than five places In particular, the ranks of hospital treatment of bacterial meningitis, malaria,...
Ngày tải lên: 13/08/2014, 11:22