... adding, editing, or deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source); ... Gets or sets a Boolean value indicating whether deletes are allowed AllowEdit Gets or sets a Boolean value indicating whether edits are allowed AllowNew Gets or sets a Boolean value indicating...
Ngày tải lên: 14/12/2013, 18:16
Tài liệu Lab 5.2.7 Establishing a Console Connection to a Router or Switch docx
... connectors a Examine the router or switch and locate the RJ-45 connector labeled “Console” Step Identify the computer serial interface, which is COM or a It should be a or 25-pin male connector labeled ... connector If the serial interface on the PC or dumb terminal is a DB-25, an RJ-45 to DB-25 adapter will be needed Both of these adapters typically come with a Cisco router or switch Step Locate or ... Locate or build a rollover cable Use a rollover cable If necessary, make one of adequate length to connect the router or switch to a workstation 2-6 CCNA 1: Networking Basics v 3.0 - Lab 5.2.7 Copyright...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... MIR-D40 (Sanyo, Osaka, Japan) To amplify the DNA fragments containing a complete x-5 gliadin gene, oligonucleotides, 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, ... immunoassay for inhibition test Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) ... gliadin, a major allergen in wheatdependent exercise-induced anaphylaxis J Biol Chem 279, 12135–12140 Morita E, Matsuo H, Mihara S, Morimoto K, Savage AW & Tatham AS (2003) Fast x-gliadin is a...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... nucleotides) Data analysis was performed using an ITC-Origin calorimeter (Microcal ⁄ GE Healthcare) Size-exclusion chromatography Analytical gel filtration experiments were performed using a Superdex ... encephalomyocarditis virus Virology 256, 8–14 11 Itsui Y, Sakamoto N, Kurosaki M, Kanazawa N, Tanabe Y, Koyama T, Takeda Y, Nakagawa M, Kakinuma S, Sekine Y et al (2006) Expressional screening ... found rate constants that were approximately 100-fold lower for mant-GTP and approximately 30-fold lower for mant-GDP than those reported for hGBP1 [9] The association rate constants (kon) for mant-GDP...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Characterization of the molten globule state of retinol-binding protein using a molecular dynamics simulation approach ppt
... native RBP, for the 16 000 conformers taken at 10-ps intervals along the unbiased simulations The radius of gyration and RMSD values are calculated using all heavy atoms The black diamond corresponds ... the conformational space The large number of diverse and moderately non-native conformations generated with this biased molecular dynamics approach are then used as initial conformations for unperturbed, ... conformers have an RMSD in the range ˚ ˚ 4–7 A and an Rg in the range 16.5–17.7 A, while ˚ and an group conformers have an RMSD above A ˚ Rg greater than 17 A The characteristics of the group conformers...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "Fast Semantic Extraction Using a Novel Neural Network Architecture" docx
... labeled for each particular verb as so-called frames Additionally, semantic roles can also be labeled with one of 13 ARGM adjunct labels, such as ARGM-LOC or ARGM-TMP for additional locational ... locational or temporal information relative to some verb Shallow semantic parsing has immediate applications in tasks such as meta-data extraction (e.g from web documents) and question and answer based ... aspect, voice, and form of the verb As our algorithm outputs a semantic tag for each word of a sentence, we directly compare this per-word accuracy with ASSERT Because ASSERT uses a parser, and...
Ngày tải lên: 17/03/2014, 04:20
UNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 2. USING A DATABASE FOR DOCUMENT RETRIEVALNOTE pot
... group working • Integration with applications and workflow systems Database management systems - Using a database for document retrieval - page 13 Information portals An information portal can provide ... know that an instance of a 'technical document' can have a title and subject Database management systems - Using a database for document retrieval - page 10 Metadata search We can implement an indexed ... Database Click on your answer Database management systems - Using a database for document retrieval - page 12 Information portals In the past few years, organizations and enterprises are increasingly...
Ngày tải lên: 31/03/2014, 20:20
UNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 3. USING A DATABASE FOR DOCUMENT MANAGEMENTNOTE pptx
... Meta Data Database File System Users Management 2) managing document content and metadata inside the same database System Document Meta Data Document Documents Database Using a database for management ... mechanisms for configuring ‘compound’ documents Database management systems - Using a database for document management - page Using a database for management If you decide to use a database, ... page Using a database for management There are advantages to using systems that manage both document content and metadata in the same database: Users Management System Document Document Meta...
Ngày tải lên: 31/03/2014, 20:20
Module 5 –Operating a Network Using Multiple Routing Protocols doc
... Khoa - www.bkacad.com CCNP – BSCI Bachkhoa Networking Academy Redistributing Route Information Factors that have the most impact on redistribution include: –Metrics –Administrative distance ... Networking Academy Modifying Administrative Distance Router(config-router)# distance administrative distance [address wildcard-mask [access-list-number | name]] Used for all protocols except EIGRP and ... Bachkhoa Networking Academy Examples BSCI © 2008 Cisco Systems, Inc All rights reserved Học viện mạng Bách Khoa - www.bkacad.com 39 CCNP – BSCI Bachkhoa Networking Academy Example: Redistribution Using...
Ngày tải lên: 06/07/2014, 23:21
Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx
... chemoradiation a standard treatment for locally advanced rectal cancer Another drug, oxaliplatin, has become widely used in adjuvant [4], as well as palliative [5,6] treatment of colorectal cancer ... to Margaretha Olsson and Christina Boll for all help with breeding and treating the animals and jejunal sample preparation References the radiosensitization observed for 5-FU and oxaliplatin alone ... of Oxaliplatin/5-Fluorouracil/Leucovorin in the Adjuvant Treatment of Colon Cancer (MOSAIC) Investigators: Oxaliplatin, Fluorouracil, and Leucovorin as Adjuvant Treatment for Colon Cancer N Engl...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo sinh học: " Computing marginal posterior densities of genetic parameters of a multiple trait animal model using Laplace approximation or Gibbs sampling" doc
... LaplaceE approximations yielded very accurate estimates of summary statistics In general, estimates based on approximation [9] were more accurate than estimates using LaplaceE For marginal means, ... here the canonical transformation can be used to transform the correlated traits to uncorrelated variables This allows us to sample the location parameters on the canonical scale using equation (14), ... Gelfand AE, Smith AFM (1990) Sampling-based approaches to calculating marginal densities J Am Stat Assoc 85, 398-409 Gelman A, Carlin JB, Stern HS, Rubin DB (1995) Bayesian Data Analysis Chapman...
Ngày tải lên: 09/08/2014, 18:22
Báo cáo khoa học: " Ventilator-associated pneumonia using a heated humidifier or a heat and moisture exchanger: a randomized controlled trial [ISRCTN88724583]" ppsx
... include 60 patients per group Quantitative variables are reported as the mean ± standard deviation, and were compared with the Student t test Qualitative variables are reported as percentages, and were ... ventilator-associated pneumonia (VAP) for heat and moisture exchangers versus heated humidifiers, adjusted for the Acute Physiology and Chronic Health Evaluation II score Heat and moisture exchanger ... it was caused by microorganisms that were never carried in the patient's oropharyngeal flora heated humidifiers (HHs) ated pneumonia using of patients remaining free of ventilator-associCumulative...
Ngày tải lên: 13/08/2014, 02:24
Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx
... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT AGTATTCAAAAGACAGCATCAGTGAT ... research REB1 AGCGAGAAACAAAGGGATAGAGGAAAAAAATTTTCTCCGTCGGCCGCGGGTGGCAAAAGC AGCGAGGAACCA -GAAAAGAATAAAAAATTTTCTCGGTCGGCCGCGGGTGGCAAAAGC AGCGAGAAACTT GAAAACGGAGAGAAAATTTTCTCCGTCGGCCTCGGGTGGCAAAAAC ... YLR387C_Spar YLR387C_Smik YLR387C_Skud YLR387C_Sbay 1E-11 AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx
... AATACATGATGAAACAcatATGAAAAAaa-aagcttttctacatattcgaggg-tttttttctgTTGGTGGa-tac TATTTAA-gaagtg AGTACATGATGAAACAcTTATAAAAaaaataagctttcTTACATGGTCTCGAGGgTTTTTCCAgctatagaaatacTATTTAAaggactA * ****** ... ctcgtgcattaagacaggctagtaTAAACGAGAAGAAGtatcctgctttgcaa TGAAACAATAGtatc-cgctaagaatttaagcaggcc tccacgcatggggattgctTGAAGAAaataggaagaaccg-gctgc TTCAACATGAAACAtcagtactatactgtcaactcctgtaggct PAR ctcctg-agtaagacagcctagtacAAATGAAAA ... ctcctg-agtaagacagcctagtacAAATGAAAA gAACCACActgctttacaataaaacaacggtacc-cactaagaattcaggcaggct MIK ctcatg-tgtacgacggccttatacaaaCAAGAAGAGCCATGCAgctttacaa TGAAACAactctacc-cactgagaatccag agact * * ** * * ***...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: "Nanoarchaea: representatives of a novel archaeal phylum or a fast-evolving euryarchaeal lineage related to Thermococcales" pps
... Archaeoglobales Methanogenium frigidum Methanomicrobiales Methanococcoides burtonii Methanosarcina barkeri * * Methanosarcina mazei Methanosarcinales Methanosarcina acetivorans Haloarcula marismortui Halobacterium ... Thermoplasma volcanium Thermoplasma acidophilum Thermoplasmatales Archaeoglobales Haloferax volcanii Methanogenium frigidum Haloarcula marismortui 0.1 * 100 100 Methanocaldococcus jannaschii Halobacterium ... thermautotrophicus 85 100 Methanosarcina 100 acetivorans 100 Methanosarcina * * mazei Methanosarcinales Methanosarcina barkeri Methanococcoides burtonii 82 Ferroplasma acidarmanus * * Archaeoglobus...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo sinh học: "Phenotypic plasticity of body pigmentation in Drosophila: Computing marginal posterior densities of genetic parameters of a multiple trait animal model using Laplace approximation or Gibbs sampling" pps
... LaplaceE approximations yielded very accurate estimates of summary statistics In general, estimates based on approximation [9] were more accurate than estimates using LaplaceE For marginal means, ... here the canonical transformation can be used to transform the correlated traits to uncorrelated variables This allows us to sample the location parameters on the canonical scale using equation (14), ... Gelfand AE, Smith AFM (1990) Sampling-based approaches to calculating marginal densities J Am Stat Assoc 85, 398-409 Gelman A, Carlin JB, Stern HS, Rubin DB (1995) Bayesian Data Analysis Chapman...
Ngày tải lên: 14/08/2014, 15:21
A Fast File System for UNIX
... processor, the hardware support for mass storage transfers, and the characteristics of the mass storage devices Disk technology is constantly improving and a given installation can have several different ... insufficient space to hold the new data) If space exists in a block already allocated, the space is filled with new data If the remainder of the new data contains more than a full block of data, a full ... the allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized...
Ngày tải lên: 12/09/2012, 14:16
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "
... of Laboratory Animals Statistical analysis The results were recorded by the principal investigator and analyzed statistically upon completion of the study The statistical analysis was performed ... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy ... control and air leaks when the authors performed recurrent thoracotomy for any reason, and confirmed the efficacy of TachoSil® as an anti-adhesive agent by performing an experimental rat study...
Ngày tải lên: 25/10/2012, 11:00
Natural botanical products have a long history in the world and are featured in using a complex
... and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the ... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits tumor promotion by 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in...
Ngày tải lên: 03/11/2012, 09:54