... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... training for students, fellows, and investigators, with the goal of producing a cadre of researchers who can translate laboratory and clinical advances into public benefit Figure Elements of an ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...
Ngày tải lên: 18/06/2014, 19:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... training for students, fellows, and investigators, with the goal of producing a cadre of researchers who can translate laboratory and clinical advances into public benefit Figure Elements of an ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...
Ngày tải lên: 20/06/2014, 03:20
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another ... Watermelon Days selected in The Best American Short Story 2002, Tom McNeal draws a picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance ... bookstore; Sang’s boyfriend, Farouk, an Egyptian American who was teaching Middle Eastern history at Harvard; Heather, the housemate of Sang and Paul, who was a law student at Boston college and her...
Ngày tải lên: 07/11/2012, 15:01
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... ⁄ iron ratio were again those of Arg20, Leu21, Asp22 and Asp23 At a : ratio, the above resonances disappeared completely, together with those of the amides of residues 29, 30 and 31 At a : protein ... water molecules (1.7 A and 1.9 A) (Fig 4E) In ˚ M5, the side chains of Asp76 (1.9 A) and Asp27 ˚ (2.4 A) of a symmetry-related molecule and four water ˚ ˚ ˚ ˚ molecules (1.9 A, 2.1 A, 3.1 A and...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: "ModelTalker Voice Recorder – An Interface System for Recording a Corpus of Speech for Synthesis" ppt
... accurately track the pitch of an utterance In these cases, the utterance will be marked unacceptable and the user should rerecord, hopefully yielding an utterance with more accurate pitch tracking Amplitude: ... of each utterance and gives the user feedback on whether the pitch is within an acceptable range This feedback mechanism also helps to eliminate cases in which the system is unable to accurately ... include automatic microphone calibration, pitch, amplitude, and pronunciation detection and feedback, and automatic phoneme labeling of speech recordings 1.2.1 Microphone calibration One important...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... cluster of S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C ... Fig ataP3, ataP4, and ataP5 encode peptides (AtaP3, AtaP4 and AtaP5) that are highly similar to Pur3, Pur4 and Pur5 from the pur cluster (Table 1) [6] These latter Fig Nucleotide and deduced amino ... complementation assays The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively (Materials and methods),...
Ngày tải lên: 21/02/2014, 01:21
Prevention of Environmental Pollution From Agricultural Activity: A CODE OF GOOD PRACTICE pot
... Manure Management Plans (also known as Farm Waste Management Plans) 4.13 Farmers should draw up a Manure Management Plan (known for the purposes of the SSAFO Regulations as a Farm Waste Management ... total volume and date of application A Manure Management Plan or FWMP will establish the quantities of slurry and manure produced and safe methods of collection, storage and land spreading, and ... poisonous gases Land application and utilisation of livestock manures and slurries 4.57 Livestock manures and slurries are a valuable asset and should be applied to agricultural land in accordance...
Ngày tải lên: 15/03/2014, 16:20
Báo cáo khoa học: "Are These Documents Written from Different Perspectives? A Test of Different Perspectives Based On Statistical Distribution Divergence" ppt
... 2003; Riloff and Wiebe, 2003), and discriminating between positive and negative language (Turney and Littman, 2003; Pang et al., 2002; Dave et al., 2003; Nasukawa and Yi, 2003; Morinaga et al., 2002) ... The Annals of Mathematical Statistics, 22(1):79–86, March Peter Turney and Michael L Littman 2003 Measuring praise and criticism: Inference of semantic orientation from association ACM Transactions ... 2(1):27– 51 Thomas M Cover and Joy A Thomas 1991 Elements of Information Theory Wiley-Interscience T Nasukawa and J Yi 2003 Sentiment analysis: Capturing favorability using natural language processing...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo Y học: Structural determination of lipid A of the lipopolysaccharide from Pseudomonas reactans A pathogen of cultivated mushrooms doc
... Negative-ion MALDI-TOF mass spectrum of intact lipid A fraction from Ps reactans Fig Negative-ion MALDI-TOF mass spectrum of ammonium treated lipid A fraction from Ps reactans A combination of ... A structure elucidated from a mushroom-associated bacterium, and the second from a nonanimal pathogenic organism, after the report on the lipid A structure of a LOS from Erwinia carotovora, a ... Geoffroy, V .A. , Alatossava, T & Meyer, J.M (2000) Application of siderotyping for characterization of Pseudomonas tolaasii and ÔPseudomonas reactansÕ isolates associated with brown blotch disease of cultivated...
Ngày tải lên: 24/03/2014, 00:21
combrune - 1758 - an essay on brewing with a view of establishing the principles of the art
Ngày tải lên: 12/06/2014, 11:27
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc
... Carcinoembryonic antigen; PBC: Primary breast cancer; LAPC: Locally advanced primary breast cancer; ABC: Advanced breast cancer; PICP: Carboxyterminal propeptide of type I procollagen; PINP: Aminoterminal ... Yde-Andersen E, Kassem M: Quantification of fetal antigen (FA-2) in supernatants of cultured osteoblasts, normal human serum, and serum from patients with chronic renal failure Nephrol Dial Transplant 1992, ... hypercalcaemia are areas that need to be explored before the use of FA-2 could be incorporated into daily clinical practice Abbreviations FA-2: Foetal antigen 2; CA15.3: Cancer antigen 15.3; CEA:...
Ngày tải lên: 09/08/2014, 03:21
báo cáo khoa học: "Long-term misuse of zopiclone in an alcohol dependent woman with a history of anorexia nervosa: a case report" pps
... abnormalities She had a long history of both anorexia nervosa and alcohol dependence Anorexia was first diagnosed in 1994, and when she was 17 years old she was treated as an inpatient By the age of ... events or trauma She also has a history of self-harm, overdosing, burning Page of and lacerating; her last admission to Accident and Emergency was two years ago Her father died of alcohol-related problems ... Nutt D: Management of insomnia: treatments and mechanisms Br J Psychiat 2007, 191:95-197 Sanger D: The pharmacology and mechanisms of action of new generation, non-benzodiazepine hypnotic agents...
Ngày tải lên: 11/08/2014, 02:22
Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx
... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... scale for receptivity/✰ and non-receptivity/✗, as well as the meaning of each type of symbol and arrow A blank scale, as in the change agenda and its locale, indicates no discernible data regarding ... receptive negative influence of an X positive influence of a Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter-organizational...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf
... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... scale for receptivity/✰ and non-receptivity/✗, as well as the meaning of each type of symbol and arrow A blank scale, as in the change agenda and its locale, indicates no discernible data regarding ... receptive negative influence of an X positive influence of a Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter-organizational...
Ngày tải lên: 11/08/2014, 16:20
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
Ngày tải lên: 12/08/2014, 03:20
LESSONS LEARNED FROM DRINKING JUST A CAN OF BEER - 08/02/2011
... thức cho: khác a thức 0) A A:N = B B: N (N nhân tử chung) A A.M (M a thức khác a thức 0) = B B.M Nếu chia tử mẫu phân thức cho nhân tử chung chúng phând) phân thức thức cho: A A:N = B B : N ... C A PHÂN THỨC Tính chất phân thức, giải thích có phân thức thể viết: A A.M = A - A 2x(x - 1) 2x B B.M a) = ; b) = (x + 1)(x - 1) x + B - B (M a thức §2 TÍNH CHẤT CƠ BẢN khác a thức 0) A A:N ... dấu A - A = B - B A - A = B - B §2 TÍNH CHẤT CƠ BẢN ?5 Dùng quy tắc đổi dấu C A PHÂN THỨC Tính chất điền a thức thích hợp vào phân thức chổ trống đẳng thức A A.M sau :y - x x - y = B B.M a) =...
Ngày tải lên: 19/10/2014, 04:00
Luận Án TS y học: Developing a model of client satisfaction with a rehabilitation continuum of care
... measuring patient satisfaction as an indicator of quality healthcare and/or as an outcome In a review of patient satisfaction in a primary healthcare setting, Pascoe (1983) ultimately defined satisfaction ... time, medical care and the evaluation of healthcare quality were being examined at a physician-patient level of interaction One indicator of the quality of medical care was the restoration of function ... extend my gratitude to Dr Susan Effgen and Dr Carl Mattacola, whose support and leadership have always been an encouragement to me I am grateful for their dedication and assistance In addition,...
Ngày tải lên: 25/07/2015, 18:36
Developing a set of legally compliant intangible asset valuation criteria and an equation supported TEV (total enterprise value) valuation approach
... approach to intangible asset valuation, and a fair value hierarchy that accommodates management representations and assumptions in the assertion and defence of valuations, in such standards as ... for addressing the historically inadequate valuation of intangible assets problem In Chapter 5, I will outline specific instances of US case law, and Australian and Singaporean standards and ... obliged, but often unable, to assert an appropriate level of recognition and value for intangible assets that draw on significant human and financial resources in their generation and maintenance II...
Ngày tải lên: 14/09/2015, 14:10
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... a bunsetsu in this manner, we can analyze a sentence in a way similar to that used when analyzing the grammatical roles of words in inflected languages like German Japanese dependencies have the ... Coarseto-fine n-best parsing and maxent discriminative reranking In Proceedings of the 43rd Annual Meeting of the ACL, pages 173–180 Manabu Sassano 2004 Linear-time dependency analysis for Japanese ... 719–724 Sadao Kurohashi and Makoto Nagao 1998b Japanese Morphological Analysis System JUMAN version 3.5 Department of Informatics, Kyoto University (in Japanese) References Eugene Charniak and Mark...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo toán học: "A Presentation of the Elements of the Quotient Sheaves Ωk /Θk in Variational Sequences" pdf
... Euler-Lagrange mapping and En+1 is the HelmholtzSonin mapping In the study of variational sequence, it is very important to give a concrete presentation of the elements [ ] ∈ Ωk /Θk It also has ... existence of global variational principles, Amer Math J 102 (1980) 781–868 N Q Chinh, Sheaf of contact forms , East-West J Math (2002) 41–55 P Dedecker and W M Tulczyjew, Spectral Sequences and the ... , where each function is defined on V5 ⊂ J Y References I M Anderson, Aspect of the inverse problem to the calculus of variation, Arch Math 24 (1988) 181–202 I M Anderson and T Duchamp, On the...
Ngày tải lên: 06/08/2014, 05:20