5 performing a customer smart search

... information on creating custom reports on flexfields data Oracle eTechnical Reference Manuals Each eTechnical Reference Manual (eTRM) contains database diagrams and a detailed description of database ... Applications tables are interrelated, any change you make using Oracle Applications can update many tables at once But when you modify Oracle Applications data using anything other than Oracle Applications, ... OTS: Default Universal Search Tab to set which tab (Quick Search, Expanded Search, or Saved Results) appears when you open Universal Search You can search information displayed in dynamic tables...

Ngày tải lên: 13/01/2014, 14:14

... D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides were expressed as percentages of the area of mM D-galactose A niger b-1,4-endogalactanase ... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was made in which galA was fused to...

Ngày tải lên: 21/02/2014, 01:21

... often, and disapproval occasionally Remind learners that they ought to know an answer or that they could provide a response if they tried Use eye contact as a correction technique Nominate and invite ... watching, someone will give him/her a nudge Eye contact is, fundamentally, time and effort saving Much of the above is likely to seem transparently obvious, only natural, and an aspect of human ... to take place Watch your learners as well as listen to them, particularly while they are performing tasks Look for signs of being bored or being lost Encourage your learners to make eye contact...

Ngày tải lên: 06/09/2013, 10:10

... (QA Training), Andy Longshaw (Content Masters) Content Lead: Janet Robinson Graphic Artist: Scott Serna (Creative Assets) Media Management: David Mahlmann Media Production: Dean Connolly (Art ... vice versa Note A word of caution with regard to XSL Transformation (XSLT) and XSL: The draft standards are in a constant state of flux, and syntax that is valid today might be invalid in a few ... HTML format Raw data held as XML can be converted into a display format such as HTML for display in a Web browser For example, consider two applications that require the same data but in a different...

Ngày tải lên: 09/12/2013, 17:15

... GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT ... CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd NM_200751 NM_001113653 ... RPE6 5a GSP-Fwd RPE6 5a GSP-Rev 13cIMH GSP-Fwd 13cIMH GSP-Rev RPE65c GSP-Fwd RPE65c GSP-Rev RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG...

Ngày tải lên: 14/02/2014, 14:20

... Program Associate MICHAEL SCHNEIDER, Senior Program Associate JUDITH URBANCZYK, Senior Program Associate HOPE HARE, Administrative Assistant PETER JAMES, Research Associate DAMIKA WEBB, Research Assistant ... States, Australia, and Denmark) that examined associations of Gulf War deployment with pulmonary-function measures or respiratory disease diagnoses based in part on such measures, such associations ... the Persian Gulf War: Recommendations for Research and Information Systems Washington, DC: National Academy Press IOM 1999 Gulf War Veterans: Measuring Health Washington, DC: National Academy Press...

Ngày tải lên: 16/02/2014, 01:20

... 1722–1724 Hirata T, Nakamura N, Omote H, Wada Y & Futai M (2000) Regulation and reversibility of vacuolar H+ATPase J Biol Chem 275, 386–389 Tsunoda SP, Aggeler R, Yoshida M & Capaldi RA (2001) Rotation ... 669–677 Sambongi Y, Iko Y, Tanabe M, Omote H, IwamotoKihara A, Ueda I, Yanagida T, Wada Y & Futai M (1999) Mechanical rotation of the c subunit oligomer in ATP synthase (F0F1): direct observation ... eukaryal V1V0 ATPases has only half the number of ion-binding sites compared to F1F0 ATP syntheses This low H+(Na+) ⁄ ATP ratio is apparently the reason for the inability of eukaryal V1V0 ATPases...

Ngày tải lên: 18/02/2014, 17:20

... Marion-Poll, A. , Caboche, M., Kamiya, Y & Koshiba, T (1998) Molecular cloning and characterization of aldehyde oxidases in Arabidopsis thaliana Plant Cell Physiol 39, 433–442 Koga, J., Adachi, T & Hidaka, ... Enterobacter cloacae indolepyruvate decarboxylase, and K.-P Rucknagel (Max¨ Planck-Society, Research Unit ÔEnzymology of protein foldingÕ, Halle/ Saale, Germany) for the amino acid sequence analysis ... E .A & Jordan, F (2001) Catalytic acid-base groups in yeast pyruvate decarboxylase.3 a steady state kinetic model consistent with the behavior of both wild-type and variant enzymes at all relevant...

Ngày tải lên: 20/02/2014, 11:20

... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... Merkamm M, ¨ Guyonvarch A, Elisakova V, Patek M, Kalinowski J, Brune I, Puhler A & Tauch A (2005) Rational design of a Corynebacterium glutamicum pantothenate production strain and its characterization ... apramycin resistance gene as selectable marker using a PCR-based system [31] The plasmid pIJ773 which has a disruption cassette containing the apramycin resistance gene [aac(3)IV] and oriT was...

Ngày tải lên: 16/03/2014, 11:20

... Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG ... B and C and may couple bound proteins to proteasomal degradation Proc Natl Acad Sci USA 96, 2071– 2076 Kamizono S, Hanada T, Yasukawa H, Minoguchi S, Kato R, Minoguchi M, Hattori K, Hatakeyama ... mechanism Cell 86, 577–587 Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN et al (1999) The JAK-binding protein JAB inhibits Janus...

Ngày tải lên: 16/03/2014, 14:20

... Sendaı¨ virus (Cantell strain, ATCC VR-907 Parainfluenza 1) was obtained from Charles River Laboratories [a- 32P]UTP, [a- 35S]UTP and [35S]-Met were purchased from Amersham-Pharmacia Biotech The anti-IFN-b ... cells and total RNA was extracted at the indicated times after the end of transfection 32P-labelled IFN-b mRNA was analysed by agarose gel electrophoresis and autoradiography (C) Polyadenylated ... the case of c-fos, it was shown that ARE mediates mRNA deadenylation by a translationindependent mechanism, while the coding region instability determinant facilitates mRNA deadenylation by a mechanism...

Ngày tải lên: 17/03/2014, 10:20

... reversetranscribed and PCR-amplified using proofreading DNA polymerase (Invitrogen), forward primer 5¢-TTCCTGC AGTGGAAACCGGCAGTGAGGCCA-3¢ and reverse Structure of deer haptoglobin primer 5¢-CGGAAAACCATCGCTAACAACTAAGCTT ... kDa for the a- chain, which is similar to that of human a2 based on a western blot (Fig 4A) Second, the molecular mass of the a- chain from a purified sample was also similar to that of human a2 ... isolation 982 A B Fig Schematic drawing of the human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always...

Ngày tải lên: 23/03/2014, 07:20

... Germany) (A) or blotted against specific antibodies (B) Lane 1: molecular mass marker Lane 2: ATP synthase preparation was denatured by incubation at 80 °C for 10 Lane 3: ATP synthase was heated ... 1/ATPase activity ATPase activity (U/mg) 1/ATPase activity Fig Ion dependence of ATP hydrolysis by the Na+ F1F0-ATP synthase from A woodii ATPase activity was measured at 30 °C using the assay ... 1700–1705 13 Sambongi Y, Iko Y, Tanabe M, Omote H, IwamotoKihara A, Ueda I, Yanagida T, Wada Y & Futai M (1999) Mechanical rotation of the c subunit oligomer in ATP synthase (F0F1): direct observation...

Ngày tải lên: 23/03/2014, 09:20

... thuyết thay đổi tổ chức tổ chức công (Theories about Organizational change in Public Organization)  Các nhân tố đóng góp vào thay đổi thành công (Factors contribute to successful change) LÝ ... để thay đổi vượt qua kháng lực (Build internal support for change and Overcome resistance)  Phạm vi tham gia rộng rãi trình thay đổi có lẽ phương pháp thường dùng để khắc phục kháng cự thay đổi ... thời gian nỗ lực với nó, quản lý cách F Đảm bảo cam kết hỗ trợ từ quản lý cấp cao (Ensure Top-Management Support and Commitment)  Sự cam kết hỗ trợ từ quản lý cấp cao đóng vai trò quan trọng...

Ngày tải lên: 16/04/2014, 02:30

... internal public relations activities Certain larger agencies and consultancies may also offer this service Advantages of using a consultancy Consultancies can offer independent advice through a range ... Disadvantages of using a consultancy Public relations concerns the internal and external communication of an organization A consultancy usually works to one person in the organization – the ‘liaison ... chapter looks at the ethical considerations of public relations work and those aspects of the law that can, and often do, affect us It is meant only as a guide and not a comprehensive legal aide-mémoire...

Ngày tải lên: 21/06/2014, 14:20

... time Other specialist journals and trade magazines, such as Ad-line, PR Week, Campaign or Photography Today, may also provide useful names and contacts, as may the Royal Photographic Society in ... equivalent, may be needed External locations These need advance planning in more detail Again, a reconnaissance before the day to pick suitable locations may be essential, especially if you are ... work has to be carried out A whole page layout, design solution or display layout may have to be scrapped and started again In the case of exhibition designs, you should always see a final artist’s...

Ngày tải lên: 21/06/2014, 14:20

... formal setting and have a formal agenda, at least for part of the meeting The adoption of the previous minutes, chairman’s address, presentation and adoption of the annual accounts and the appointment ... responsible Air travel Special arrangements may have to be made at airports to greet delegates on arrival and dispatch them with onward travel arrangements If the conference venue is abroad, sometimes a ... material, a standard facia board over the front with your organization’s name and stand number, some sort of flooring, a ceiling and basic lighting Make sure the correct details are on the facia...

Ngày tải lên: 21/06/2014, 14:20

... done, and done in such a way as to turn the situation to advantage; at the very least to limit any damage to a minimum What follows are some of the basic rules that apply whatever form a crisis may ... for the management of a crisis situation Assess Look at your organization as objectively as possible Try and imagine a situation that could arise: a major explosion in a factory, an outbreak 76 ... may have to be different, but it may be that one plan can be adapted to suit all potential crises Prepare Earmark suitable premises as a crisis operations centre and appoint key staff; allocate...

Ngày tải lên: 21/06/2014, 14:20

... have good public relations and an excellent reputation Evaluation There are three main ways to evaluate the results of a public relations programme: observation and experience; feedback and analysis; ... over a given period, a view can be taken as to whether or not the campaign was effective l A media relations campaign Was it successful? Did it produce more qualitative as well as quantitative ... material collected, analysing and classifying it so that a report can be drawn up and presented to management A ‘source’ rating, or system of categorization for reliability and accuracy may be helpful...

Ngày tải lên: 21/06/2014, 14:20

... embarrassing, expensive and can lead to litigation What makes a contract? Three components constitute a contract: an offer; an acceptance; a consideration NB A one-sided bargain, such as a gift, ... to guarantee a specific amount of favourable press coverage Conduct concerning colleagues A member shall: 4.1 Adhere to the highest standards of accuracy and truth, avoiding extravagant claims ... judged NB In a two-stage competition both parts must require a degree of skill Raffles If you are intending to run a raffle at a local carnival, craft fair, charity dinner, or any similar type of...

Ngày tải lên: 21/06/2014, 14:20