4diversity as a pre condition for creativity and innovation

... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... interfering RNA 13 1.1 Glioblastoma Malignant brain tumors such as glioblastoma multiforme (GBM) and childhood brain cancer, medulloblastoma, have remained virtually untreatable and lethal The median survival...

Ngày tải lên: 09/09/2015, 18:56

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The ... fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, and insecticides Wheat straw contains...

Ngày tải lên: 05/09/2013, 15:28

... restraints, and eight dihedral angle restraints Fifty conformations that give low conformation energy and that give no distance and dihedral angle violations greater than ˚ ˚ 0.5 A and A, respectively, ... function was applied to the t1 and t2 dimensions Peak picking and assignment were performed with sparky (T D Goddard and D G Kneller, sparky 3, University of California, San Francisco, CA) 1D and 2D ... peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody 4-B8(8) ⁄ E9 Fab fragment...

Ngày tải lên: 16/03/2014, 23:20

... vital for a rapid response As a key regulator shaping the early phase of IFNa signalling, IRF9 represents an appealing target for innovative therapeutic approaches IRF9 accelerates IFNa signal ... concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect the speed of signalling ... incubated with anti-IRF9 IgGs (Santa Cruz, CA, USA, antibody 10793) as primary antibody and anti-rabbit Alexa Fluor 680 (Invitrogen) as secondary antibody, and analysed by flow cytometry using a FACSCalibur...

Ngày tải lên: 23/03/2014, 03:20

... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... ORM PAU POL PON POR Latvian Lingala Lithuanian Luba-Lulua Luo Macedonian Madurese Malagasy Malay Malayalam Maltese Marathi Marshallese Mende Minangkabau Mongolian Mossi Nepali Norwegian Oriya Oromo...

Ngày tải lên: 25/03/2014, 10:41

... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... L-azetidine-2-carboxylic acid for 18 h (B) GmPDIM mRNA was quantified by real time RTPCR Each value was standardized by dividing the value by that for actin mRNA Fold expression change was calculated as the ratio...

Ngày tải lên: 30/03/2014, 04:20

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...

Ngày tải lên: 18/06/2014, 16:20

... TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196 TGGGTTATTGCAGTGGCGGTAGG ADAMTS-8 ... Hydroxyproline release was assayed as a measure of collagen degradation, and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [20] Collagenase and inhibitor activities in ... GATGTACCGAGGATTCACCAAGAT 356 GCCGGATGCAAGCGTAGT TIMP-4 ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA...

Ngày tải lên: 09/08/2014, 08:22

... ileocystoplasty and, for patients unable or not adapted to intermittent catheterization, Mitrofanoff’s principle (in which the vascularized ileocecal appendix is anastomosed at the skin and bladder, ... technique as a surgical option for bladder augmentation with a continent stoma: a case report Journal of Medical Case Reports 2011 5:49 Submit your next manuscript to BioMed Central and take full advantage ... skin and the appendix that is Page of anastomosed at the bladder wall with a nonrefluxing anastomosis Conclusion The association of Mitrofanoff’s principle with the Monti procedure is feasible and...

Ngày tải lên: 11/08/2014, 00:22

... h on incubation with the concentrations as indicated was analyzed using MTT assay All the measurements were done in six replicates The results are expressed as arithmetic mean ± standard error ... the amount of formazan crystals formed was measured after h of MTT addition (10% v/v) by adding isopropyl alcohol and OD measurement at 570 nm The relative cell viability in percentage was calculated ... Matsumura Y, Suzuki M, Shimizu K, Goda R, Nakamura I, Nakatomi I, Yokoyama M, Kataoka K, Kakizoe T: NK105, a paclitaxelincorporating micellar nanoparticle formulation, can extend in vivo antitumour activity...

Ngày tải lên: 11/08/2014, 08:20

... normative database and standard analysis Table 2: Quick reference simplified set of normative data for electric activity obtained by surface EMG for masseter and submental group + platisma during ... described as consisting of four stages, as the oral stage was divided into oral initial (for solids – oral preparation stage) and oral final stages [5] This staging can be helpful in diagnostic evaluation ... of a swallow The staging of normal deglutition can be clinically important as an additional tool for establishing aetiology and localization – oral, pharyngeal, or oesophageal – of causes for...

Ngày tải lên: 11/08/2014, 20:20

... The material and procedural efficacy was also assessed and modified as needed Five clients (three with a stroke and two with traumatic brain injury) as well as three occupational therapists and ... conceptualized the study, and participated in its design, statistical analysis and drafted the manuscript MG and AVDM participated in its design, data collection and statistical analysis All authors ... the domains which are viewed as important for inclusion at this stage of the rehabilitation process can be classified as activity domains (learning and thinking, Harty et al Health and Quality...

Ngày tải lên: 12/08/2014, 00:20

... IL-9 as a candidate gene for asthma Significant biological variability in airway responsiveness in rodents has also been observed [39,40] Linkage studies in mice associate AHR with a small region ... development of the allergic asthmatic response Importantly, increased lung IL-9 expression in mice and humans is tightly and specifically associated with asthma and its risk factors; decreased IL-9 is ... as an asthma candidate gene by unbiased genetic mapping studies on AHR and linkage homology in both humans and mice Cell biology in vitro has shown that IL-9 is an important growth factor and stimulator...

Ngày tải lên: 12/08/2014, 18:20

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... between ETS for respiratory diseases such as adult and pediatric asthma Also a series of epidemiological analyses on parental smoking and respiratory health in children have been performed [60,64,65,4,66-71] ... study assessed the correlation of ETS exposure with the expression of inflammatory mediators in airway secretions of children with asthma IFN-gamma and IL-12, as well as IL-5 and IL-13 Table 1: Association...

Ngày tải lên: 13/08/2014, 08:20

... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (

Ngày tải lên: 13/08/2014, 16:20

... Matumaru, Akio Ohotake, Yoshichika Takamura, Tokujiro Adia and Masayasu Nakano (1989), “Development of a Solid medium for Growth and Isolation of Axenic Microcystis Strains (Cyanobacteria) ”, Appl ... medium for strain was f/2 The Isochrysis galbana strain showed a huge range of fatty acids among, contained remarkable amount of PUFA and considerate level of EPA and DHA which play an essential ... Myristic acid Palmitic Acid Palmitoleic Acid Stearic Acid Oleic Acid Linoleic Acid Anpha-Linoleic Acid Octadecatetraenoic Eicosapentaenoic Acid (EPA) Benhenic acid Docosahexaenoic Acid (DHA) 4.16...

Ngày tải lên: 13/08/2015, 00:34

... of mucosal routes have been considered for vaccination purposes, including the oral, nasal, rectal and vaginal routes By far oral and intranasal vaccinations have been the most commonly and extensively ... particular, the universal influenza vaccine candidate M2e was expressed in BPZE1 as a FHA-(M2e)3 chimera and the nasal administration of the recombinant BPLR3 bacteria triggered significant production ... hemagglutinin (HA) and neuraminidase (NA) However, HA and NA can undergo mutations through antigenic drift and shift, the vaccine formulations need to be changed on a yearly basis in order to match...

Ngày tải lên: 11/09/2015, 10:00

... classical theories of comparative advantage It regards the environmental standard of a country as an important factor which shapes the country’s comparative advantage in international trade and ... removal of trade barriers such as tariffs, regulations, certain standards, legislation and regulatory measures, as well as removal of restrictions on capital flows and investments play a crucial ... of all toxins, hazardous wastes, and radioactive materials and demands that all past and current producers be held strictly accountable to the people for detoxification and the containment at...

Ngày tải lên: 14/09/2015, 18:30

... that glial cells also play a part in exaggerated pain states created by inflammation and neuropathy (Hashizume et al., 2000; Watkins and Maier, 2002) Astrocytes, in particular, play an important ... my days as a researcher Thank you both so much for all the fun and laughter you have brought to my days in the laboratory I am also very grateful to Ms Jeyapriya Raja Sundaram for her help and ... cells are activated and release pro-inflammatory cytokines and other pain enhancing substances This affects the presynaptic release of neurotransmitters, postsynaptic excitability, as well as a self-propagating...

Ngày tải lên: 02/10/2015, 17:15