4 5 the bjt as a switch

Lab 5.1.13b Building a Switch-based Network

Lab 5.1.13b Building a Switch-based Network

... Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 255 . 255 . 255 .0 Not Required PC – B 192.168.1.2 255 . 255 . 255 .0 Not Required Step Access the Command or MS-DOS prompt a Use the Start menu ... patch cable Locate two cables that are long enough to reach from each PC to the switch Attach one end to the NIC and the other end to a port on the switch Be sure to examine the cable ends carefully ... workstations Step Identify the proper Ethernet cable and connect the two PCs to the switch a The connection between the two PCs and the switch will be accomplished using a Category or 5e straight-through...

Ngày tải lên: 05/11/2013, 12:15

4 533 0
Tài liệu Lab 5.1.13b Building a Switch-based Network pptx

Tài liệu Lab 5.1.13b Building a Switch-based Network pptx

... Computer IP Address Subnet mask Default Gateway PC – A 192.168.1.1 255 . 255 . 255 .0 Not Required PC – B 192.168.1.2 255 . 255 . 255 .0 Not Required Step Access the Command or MS-DOS prompt a Use the Start menu ... patch cable Locate two cables that are long enough to reach from each PC to the switch Attach one end to the NIC and the other end to a port on the switch Be sure to examine the cable ends carefully ... workstations Step Identify the proper Ethernet cable and connect the two PCs to the switch a The connection between the two PCs and the switch will be accomplished using a cat or 5e straight-through...

Ngày tải lên: 11/12/2013, 14:15

4 574 0
Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

... 20 04 as a Firewall What Is a TCP/IP Packet? Network Interface Layer Internet Layer Transport Layer Application Layer Destination Address: 0003FFD329B0 Source Address: 0003FFFDFFFF Physical payload ... well-known attack methods and raises an alert when an attack is detected Detects well-known IP attacks Includes application filters for DNS and POP that detect intrusion attempts at the application level ... What Is System Policy? System policy is: A default set of access rules applied to the ISA Server to enable management of the server A set of predefined rules that you can enable or disable as...

Ngày tải lên: 27/02/2014, 05:20

31 470 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

... Endothelin-1 system in the bovine oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 20 04, 44 Suppl 1:S 248 -51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi ... 47 48 49 50 51 52 53 54 55 56 Goel P, Radotra A, Singh I, Aggarwal A, Dua D: Effects of passive smoking on outcome in pregnancy J Postgrad Med 20 04, 50 :12-16 Neal MS, Hughes EG, Holloway AC, ... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and...

Ngày tải lên: 05/03/2014, 17:20

17 733 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx

... 59 .3 4. 2 58 .4 4. 2 57 .0 4. 2 67.0 4. 0 65 .4 4. 1 67.0 4. 0 66.0 4. 1 Table 5: Relations between nominals: evaluation on the SemEval dataset Accuracy is macro-averaged (in %s), up to 10 Google stars are ... followed by accuracy and coverage (in %s) Model v+p v+p+c v v+c p+c p baseline LRA 240 238 2 34 230 1 14 110 49 239 × 352 3 54 350 362 47 1 47 5 551 361 ∅ 8 16 15 15 0 Accuracy 40 .5 3.9 40 .2±3.9 40 .1±3.9 ... verbal analogy problems, yielding 47 % accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve...

Ngày tải lên: 08/03/2014, 01:20

9 390 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... online has risen dramatically, and the percentage meeting through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based ... as high as 5% , whereas 17% of heterosexual couples met through family in 19 85, and as many as 25% of heterosexual couples met through family in the 1 940 s Social and geographic distance from the ... survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and Hispanics are the two groups that contribute most to racial and ethnic intermarriage in the US...

Ngày tải lên: 15/03/2014, 21:20

50 470 0
A Portrait of the Artist as a Young Man ppt

A Portrait of the Artist as a Young Man ppt

... trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again the vacation It was like a train going in and out ... It was only for cod I’m sorry The face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another ... dead things The prefect was there again and it was his voice that was saying that he was to get up, that Father Minister had said 22 A Portrait of the Artist as a Young Man he was to get up and...

Ngày tải lên: 31/03/2014, 14:20

317 342 0
báo cáo hóa học:" The PedsQL™ as a patient-reported outcome in children and adolescents with Attention-Deficit/Hyperactivity Disorder: a population-based study" pdf

báo cáo hóa học:" The PedsQL™ as a patient-reported outcome in children and adolescents with Attention-Deficit/Hyperactivity Disorder: a population-based study" pdf

... children ages 2 4 DataStat, a nationally-based survey administration firm located in Michigan, was contracted to administer the California SCHIP statewide mail survey DataStat mailed the PedsQL™ 4. 0 ... (1 .4% ) American Indian or Alaskan Native, and (11.1%) missing Mean socioeconomic status (SES) was 32 . 45 (SD = 15. 61), indicating on average a lower middle class sample based on the Hollingshead ... %) Asian/ Pacific Islander, 13 (0 .4 %) American Indian or Alaskan Native, and 340 (10 .4 %) missing The statewide SCHIP sample was representative of low-income families (≤ 250 % of the federal...

Ngày tải lên: 20/06/2014, 15:20

10 538 0
Báo cáo toán học: " Code choice in the Chinese as a foreign language classroom" pot

Báo cáo toán học: " Code choice in the Chinese as a foreign language classroom" pot

... classroom Canadian Modern Language Review 57 (3): 40 2 -42 3 Crawford, James 20 04 Language choices in the foreign language classroom: Target language or the learners’ first language? Regional Language Centre ... Charlene, and Patricia Duff 19 94 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... press) The use of English as a lingua franca in teaching Chinese as a foreign language: A case study of native Chinese teachers in Beijing In Language alternation, language choice and language encounter...

Ngày tải lên: 20/06/2014, 21:20

26 523 0
báo cáo hóa học:" Code choice in the Chinese as a foreign language classroom" pptx

báo cáo hóa học:" Code choice in the Chinese as a foreign language classroom" pptx

... classroom Canadian Modern Language Review 57 (3): 40 2 -42 3 Crawford, James 20 04 Language choices in the foreign language classroom: Target language or the learners’ first language? Regional Language Centre ... Charlene, and Patricia Duff 19 94 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... press) The use of English as a lingua franca in teaching Chinese as a foreign language: A case study of native Chinese teachers in Beijing In Language alternation, language choice and language encounter...

Ngày tải lên: 21/06/2014, 17:20

26 501 0
Báo cáo hóa học: "Code choice in the Chinese as a foreign language classroom" potx

Báo cáo hóa học: "Code choice in the Chinese as a foreign language classroom" potx

... classroom Canadian Modern Language Review 57 (3): 40 2 -42 3 Crawford, James 20 04 Language choices in the foreign language classroom: Target language or the learners’ first language? Regional Language Centre ... Charlene, and Patricia Duff 19 94 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... press) The use of English as a lingua franca in teaching Chinese as a foreign language: A case study of native Chinese teachers in Beijing In Language alternation, language choice and language encounter...

Ngày tải lên: 21/06/2014, 19:20

26 391 0
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx

... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... the work on the spot, and, as capital is usually forthcoming, the estancias are run in such a way as to yield the greatest possible return They are usually well-maintained, up-to-date in management ... seed alfalfa is sown as well When the last crop has been cut, the latter grows through the stubble The growth of this plant is such that as alfalfa is more cultivated, the stock-bearing capacities...

Ngày tải lên: 28/06/2014, 19:20

199 354 0
The Manager as a Planner and Strategist pdf

The Manager as a Planner and Strategist pdf

... & Mauritz, and England’s Jaeger and Laura Ashley, have attempted to supply fashionable clothes at lower prices, none has succeeded as well as Spanish clothes maker, Zara, whose sales have soared ... recent The Manager as a Planner and Strategist 277 years .51 Zara has managed to position itself as the low price/cost leader in the fashion segment of the clothing market because of the way it ... products and uses a different marketing approach than its North American division Global and multidomestic strategies both have advantages and disadvantages The major advantage of a global strategy...

Ngày tải lên: 05/07/2014, 19:20

38 526 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx

Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx

... visualized as dots on metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to ... such as cartilaginous fish [59 , 75] , salamanders [55 ] or monotreme [79] Moreover, general features of bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance ... consider them as ancestral chromosomes although they are very rare in fish and batracians Indeed, they could have been inherited from a common ancestor of the vertebrates, as they can be encountered...

Ngày tải lên: 09/08/2014, 18:21

11 318 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx

... Oral Maxillofac Surg 2003, 61(9):11 15- 1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well as the region surrounding ... histological examination and was a major contributor in writing the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing...

Ngày tải lên: 10/08/2014, 23:20

4 234 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot

... endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared complete The patient ... Endometriomas appear homogeneously hyperintense on T1-weighted sequences [10] MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed ... of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these cases...

Ngày tải lên: 11/08/2014, 14:21

3 384 0
báo cáo khoa học:" The ICF as a common language for rehabilitation goal-setting: comparing client and professional priorities" ppt

báo cáo khoa học:" The ICF as a common language for rehabilitation goal-setting: comparing client and professional priorities" ppt

... across the nine ICF activities and participation domains The Friedman analysis is a nonparametric statistical test which is an alternative to the repeated analysis of variance measure Statistical ... cm cardboard, cut out and laminated and velcro was attached to the back for easy placement on a regular short pile mat These line drawings could then be placed by the participants on the mat under ... its design, statistical analysis and drafted the manuscript MG and AVDM participated in its design, data collection and statistical analysis All authors read and approved the final manuscript Competing...

Ngày tải lên: 12/08/2014, 00:20

9 324 0
Báo cáo y học: "Genomic studies of mood disorders - the brain as a muscle" pot

Báo cáo y học: "Genomic studies of mood disorders - the brain as a muscle" pot

... may become a useful supplement to pharmacotherapy and psychotherapy, with a treadmill supplanting the proverbial Freudian couch The Romans may have had it right with their ideal of mens sana ... Toyooka K, Iritani S, Niizato K, Nakamura R, Tsuchiya K, Someya T, Kakita A, Takahashi H, Nawa H: Abnormal expression of epidermal growth factor and its receptor in the forebrain and serum of schizophrenic ... brains from bipolar patients As a caveat, Evans et al [5] present data from a relatively small number of subjects; this is typical of the human postmortem work published so far and is due to the...

Ngày tải lên: 14/08/2014, 14:21

4 161 0
slike bài giảng ứng dụng xây dựng hệ thống thông tin chương 3 the analyst as a project manager

slike bài giảng ứng dụng xây dựng hệ thống thông tin chương 3 the analyst as a project manager

... for research paper WBS is foundation for project schedule Building a PERT/CPM Chart Assists in assigning tasks Critical path method Gantt chart and tracking GANTT chart Systems Analysis and Design ... Overlap of SDLC Phases with Ongoing Project Management Tasks Systems Analysis and Design in a Changing World, 3rd Edition 10 Project Management Tasks Corresponding to Phases of the SDLC Systems Analysis ... 17 Activities of the Project Planning Phase Systems Analysis and Design in a Changing World, 3rd Edition 18 Activities of the Project Planning Phase and Their Key Questions Systems Analysis and...

Ngày tải lên: 24/10/2014, 15:36

40 310 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... 7 .5 µl reaction mix (containing reaction buffer and thermostable polymerase) in a total volume of 15 L The thermal cycle was: at 50 °C, 10 at 95 C and 40 cycles of 15 sec at 95 C and 20 sec at...

Ngày tải lên: 15/05/2015, 00:37

58 262 0
w