4  viewing the nested members of a group

... significant 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ ... 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ ... 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ 5¢-CGGGATCCAGCAGTATGGTGTCCGTG-3¢ 5¢-GGAATTCACCGTCACTTCGCTTGAG-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCAGGGTGTCATAGGCCA-3¢...

Ngày tải lên: 20/02/2014, 02:21

... 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase gene family ... 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... Substrate Km(lM) Relative Vmax (% of coumarate) Relative Vmax/Km (lM)1) Gm4CL1 Cinnamate 4-Coumarate Caffeate Ferulate Sinapate 3,4-Dimethoxycinnamate Cinnamate 4-Coumarate Caffeate Ferulate Sinapate...

Ngày tải lên: 22/02/2014, 04:20

... mechanism might be considered as an extracellular counterpart of the chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that 5138 are abundantly expressed in nasal ... by the lachrymal and lingual salivary glands, and has been found to be expressed by several other secretory tissues such as prostate, mucosal glands of the tracheobronchial tree, nasal mucosa and ... m)1Æcm)1) after dilution in water AMA was from Sigma Aldrich (Milan, Italy) All other reagents, purchased from different companies, were of analytical grade Rabbit serum raised against HNE–protein adducts...

Ngày tải lên: 23/03/2014, 10:20

... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein, ... TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements both in the locked, inactive state and in the unlocked state ... 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned into the plasmid pKF18 via the EcoRI and SalI restriction sites in the multicloning site This plasmid was designated as...

Ngày tải lên: 31/03/2014, 07:20

... Ex: The senile old man disease Many case of infectious A story as old as time The Phrase A noun phrase: A noun phrase consits of a noun and all it modifies Ex: The senile old man Many case of ... The Phrase What is a Phrase? Phrase as a group of words, which makes sence, but not complete sense, it called a Phrase It is a group of related words without a subject and a verb Word /group of ... that “ she” functions in exactly the same way as “ The beautiful girl” and “ arrived” in exactly the way as “ has arrived” Concentrating on the similarity of function, they define a noun phrase...

Ngày tải lên: 13/07/2014, 23:26

... are realized as actions of the automorphism group of a graph on its vertex set Following Tymoczko, it seems natural to expand the notion of the distinguishing set of a group to include all of its ... 2; these include all groups of squarefree order Albertson and Collins’ results for Abelian and dihedral groups are special cases of nilpotent groups of class and metacyclic groups, respectively ... that any subgroup L of G/N has the property that D(L) ≤ c Then D(G) ≤ c + Proof The case G = is trivial Suppose that a nontrivial group G acts faithfully on a set X Choose a set U of representatives...

Ngày tải lên: 07/08/2014, 13:21

... The technical aspects of the proof are given in Section 3, roughly as follows On the one hand, the statement of the theorem says something about the possible orders of a basis for Zn when that ... a basis A of large order, and from there we can establish the result Despite our main theorem and previous existence results, we remain far from a complete characterization of the possible basis ... Freiman-Vosper theorem For a proof of that ‘classical’ result, see Theorem 2.10 in [N] The third and last result from the literature that we shall use is a special case of a result of Lev [L], generalising...

Ngày tải lên: 08/08/2014, 12:22

... increment at steady state beating Wave only, T = 0.7 s run Downstream cylinder placed at x = ½ D, y = 373 Appendix H Iso Surface Plots of Numerical Wave Tank Figure H1 Iso surface plots of wave and ... T=0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0) Figure H12 Iso surface plots of wave only run, T = 0.7s, at time intervals of T’ (At Steady State ... T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H8 Iso surface plots of wave only run, T = 0.7s, at time intervals of T (At Steady State Downstream cylinder spacing...

Ngày tải lên: 10/09/2015, 15:54

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made in the child DataTable This is the default None ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent...

Ngày tải lên: 24/12/2013, 01:17

... gliomas, malignant astrocytomas and medulloblastomas [82,93,94] The oncogenic transformation mediated by the autocrine PDGF loop takes place through activation of the ras ⁄ MAPK pathway that increases ... feeding and breathing, as they have a complete cleft of the secondary palate because the palate bones not meet Additionally, the dorsal spinal cord was deformed in the lower spine The null mutant ... removal of the CUB domains and thereby activation of the growth factor domains PDGF-C and -D contain both the CUB and growth factor domains when they are secreted and proteolytic cleavage is therefore...

Ngày tải lên: 19/02/2014, 07:20

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...

Ngày tải lên: 19/02/2014, 16:20

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...

Ngày tải lên: 07/03/2014, 14:20

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

Ngày tải lên: 08/03/2014, 02:21

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a...

Ngày tải lên: 08/03/2014, 22:20

... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...

Ngày tải lên: 08/03/2014, 22:20

Ngày tải lên: 12/03/2014, 00:21