... the 4-kDa peptide N-terminal primer: 5¢-AACCATGGCTAAAGCAGATTGTAATGG TGCATGT-3¢; the 4-kDa peptide C-terminal primer: 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned ... were amplified by PCR strategy using the azuki bean and mung bean genomic DNAs as templates and the synthetic primers legF1 (5¢-AGC AGCAGATTGTAATGGTG-3¢) and legR1 (5¢-CAGC ACTTCAGAATCAGAGTC-3¢) ... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein,...
Ngày tải lên: 31/03/2014, 07:20
... Combettes and S A Hirstoaga, “Equilibrium programming in Hilbert spaces,” Journal of Nonlinear and Convex Analysis, vol 6, no 1, pp 117–136, 2005 A Moudafi and M Th´ ra, “Proximal and dynamical approaches ... spaces,” Journal of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 11 S Takahashi and W Takahashi, “Strong convergence theorem for a generalized equilibrium problem and ... problems,” Journal of Mathematical Analysis and Applications, vol 344, no 1, pp 340– 352, 2008 10 S Takahashi and W Takahashi, “Viscosity approximation methods for equilibrium problems and fixed point...
Ngày tải lên: 21/06/2014, 11:20
Tài liệu Module 4: Creating and Deploying an Image of Windows 2000 Professional pptx
... is created and deployed Lead-in An image is a duplicate of a hard disk that contains a preinstallation or installation of Windows 2000 Professional Disk Imaging Application You create an image ... Creating and Deploying an Image of Windows 2000 Professional Install and configure applications An application should be preinstalled with an image only if all users need that application Applications ... knowledge and skills to create and deploy an image of a preinstallation or installation of Microsoft® Windows® 2000 Professional, which includes preparing a reference computer, creating an image by...
Ngày tải lên: 17/01/2014, 08:20
Tài liệu FRONTIERS IN UNDERSTANDING CLIMATE CHANGE AND POLAR ECOSYSTEMS REPORT OF A WORKSHOP docx
... observations, data synthesis and management, and data dissemination and outreach Copyright © National Academy of Sciences All rights reserved Frontiers in Understanding Climate Change and Polar ... University of Victoria, Canada SVEN D HAAKANSON, Alutiiq Museum, Kodiak, Alaska AMY LAUREN LOVECRAFT, University of Alaska, Fairbanks MOLLY MCCAMMON, Alaska Ocean Observing System, Anchorage ELLEN MOSLEY-THOMPSON, ... Sea ice also provides an important habitat for birds and mammals (e.g., penguins, polar bears, walrus, and seals) that use the ice as a foraging platform or breeding habitat Arctic and Antarctic...
Ngày tải lên: 17/02/2014, 19:20
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx
... a seamless web They cannot be separated, and they stand or fall together Ron Paul understands that all three parts of this system of liberty have been under grave attack for decades, and that ... delight of the bureaucrats, politicians, international bankers, multinational corporations, and some labor leaders The age of the managed fiat currency was born The M anaged Fiat Currency Standard As ... standard, the CPI increased 10 percent In his 1848 Communist Manifesto, Karl Marx urged: “Centralization of credit in the hands of the state, by means of a national bank with state capital and...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
... Correas I, Nieto A & Avila J (1988) Tau factor polymers are similar to paired helical filaments of Alzheimer’s disease FEBS Lett 236, 150–154 42 Mendieta J, Fuertes MA, Kunjishapatham R, SantaMaria ... shifts and negative values are upfield shifts NH and 0.10 p.p.m for aH) In general, the chemical shift of NH deviates was more than that of aH upon phosphorylation Notable chemical shift deviation of ... CD spectra for R4 and pR4 are characterized by a strong negative apex at 198 nm (Fig 3), which indicates a large amount of random coil structure [36] No remarkable structural perturbation is...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... La Jolla, CA, USA) with pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, ... Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and Met95 mutants of the isolated ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
Ngày tải lên: 16/03/2014, 13:20
Measuring and modelling the performance of a parallel ODMG compliant object database server potx
... optimization and parallelization are automatic, having as a result an operator tree that represents a query’s evaluation plan Although all of them implement some form of intra-transaction parallelism, ... development of a parallel object database server is given in [14] An early parallel object database project was Bubba [15], which had a functional query language FAD Although the Bubba model and languages ... Muralikrishna M Gamma a high performance dataflow database machine Proceedings of the International Conference on Very Large Data Bases, Kyoto, Japan, August 1986 Morgan Kaufmann: San Mateo, CA,...
Ngày tải lên: 17/03/2014, 00:20
synthesis, electrical measurement, and field emission properties of a-fe2o3 nanowires
... is a constant for all of the as-produced a- Fe2O3 NWs Using the mean length and radius of the NWs, RNW (or Roverall) of samples A, B, C, and D was calculated as 1.25 1011, 1.4 1011, 1.4 1011, and ... Nanoscale Res Lett (2008) 3:330–337 331 thermally stable, resistant to oxidation, and have a high aspect ratio, a- Fe2O3 NWs are a candidate emitters for FE applications It has been reported ... the contact resistance between the CAFM tip and the NW RNW and Rfilm are the resistances of the NW and the film, respectively The overall resistance (Roverall) is the sum of Rcontact, RNW, and Rfilm...
Ngày tải lên: 20/03/2014, 13:08
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... key trading-partner areas Internal Audit 2012 14 • The CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary ... internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing have made ... internal audit today and in the future As organizations expand to take advantage of global markets and supply chains, internal audit faces a burgeoning need for its services A majority of survey...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG ... Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG ... LumiGLOTM was from Cell Signaling (Beverly, MA, USA), and AdvantageÒ polymerase mix was from Clontech (Palo Alto, CA, USA) All other reagents were of the best quality and commercially available Expression...
Ngày tải lên: 23/03/2014, 09:21
ELECTRONIC SCIENTIFIC, TECHNICAL, AND MEDICAL JOURNAL PUBLISHING AND ITS IMPLICATIONS REPORT OF A SYMPOSIUM docx
... early adopters reap the benefits of innovation in attracting authors and readers Eventually, many of the innovative features become generally adopted, and usually at a lower cost of adoption than ... well-known example of such an open access archive is PubMed Central, maintained by the National Library of Medicine Advantages of the Open-Access Approach for Science The practical advantages of true ... scientific and technical matters Dr Bruce M Alberts is president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy...
Ngày tải lên: 29/03/2014, 11:20
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... kcat value compared with the methyl substituted substrate Discussion HPDA hydratase, an enzyme in the meta-cleavage pathway of aromatic compounds, catalyzes a hydration reaction via a proposed anion ... preparation after anion exchange (lane 2); preparation after hydrophobic column chromatography (lane 3), preparation after gel filtration (lane 4) The molecular mass of the proteins in the standard...
Ngày tải lên: 30/03/2014, 15:20
the impact of internet banking on banks a descriptive and evaluative case study of a large united states bank (lusb)
... initiating transactions such as deposits and loans (Siebel, 2005) Some banks also shifted some activities traditionally offered by bank branches such as small-business loan approval and management ... setup an account with PayPal first and then use an email for communicating All the information is transferred to all the parties involved in the auction transactions via email Amazon has an extensive ... impersonal and emotionless The use of automated answering machines and computer robots that handled customer calls after working hours were impersonal, and a live person was not easily available...
Ngày tải lên: 03/06/2014, 02:15
báo cáo hóa học:" Mid-term results and factors affecting outcome of a metal-backed unicompartmental knee design: a case series" pptx
... femoral and tibial angles, alpha and beta angles, and medial and lateral joint spaces as described by Villers and Cartier [7] Patients were additionally evaluated for the presence of patellar osteophytes ... the data TMS, LPL, JX, DRM, MGZ, analyzed the data TMS, MAM, DRM, MGZ, prepared the manuscript MAM, JX, MGZ, PMB ensured the accuracy of the data and analysis All authors have read and approved ... standard deviation ap values were calculated based on Wilcoxon matched-pairs signed-ranks tests for continuous variables and chi-squared tests for categorical variables a mean of 95 (SD = 4) and...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
... control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear uncertain ... stability criteria have been given in terms of a set of linear matrix inequalities, and stabilization periodically intermittent state feedback controllers are proposed Finally, a numerical example ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This...
Ngày tải lên: 21/06/2014, 06:20
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx
... parameterized architecture dedicated to image analysis applications on FPGA All flows and data are analyzed to propose two generic NoC architectures, a ring for results and command and a dedicated ... structure is dynamic in order to adapt to different types of data The length of packet and data, number and size of flits, and the depth of VC are all parameterized The size of flits can be 8, 16, ... or wavelength interval Each individual image has usually the same physical area and scale but a different spectral band Other applications are presented in [27, 28] The aim of the multispectral...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article An Extragradient Approximation Method for Equilibrium Problems and Fixed Point Problems of a Countable Family of Nonexpansive Mappings" docx
... problems and fixed point problems in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 Rabian Wangkeeree 17 12 K Aoyama, Y Kimura, W Takahashi, and ... W Takahashi, Nonlinear Functional Analysis, Yokohama Publishers, Yokohama, Japan, 2000 14 R T Rockafellar, “On the maximality of sums of nonlinear monotone operators,” Transactions of the American ... such scheme In this paper, motivated by Yao et al 10 , S Takahashi and W Takahashi 11 and Aoyama et al 12 , we introduce a new extragradient method 4.2 which is mixed the iterative schemes considered...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo hóa học: " Synthesis, Electrical Measurement, and Field Emission Properties of a-Fe2O3 Nanowires" potx
... is a constant for all of the as-produced a- Fe2O3 NWs Using the mean length and radius of the NWs, RNW (or Roverall) of samples A, B, C, and D was calculated as 1.25 1011, 1.4 1011, 1.4 1011, and ... Nanoscale Res Lett (2008) 3:330–337 331 thermally stable, resistant to oxidation, and have a high aspect ratio, a- Fe2O3 NWs are a candidate emitters for FE applications It has been reported ... the contact resistance between the CAFM tip and the NW RNW and Rfilm are the resistances of the NW and the film, respectively The overall resistance (Roverall) is the sum of Rcontact, RNW, and Rfilm...
Ngày tải lên: 22/06/2014, 01:20