4 executing an activity at a specific point in time
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
Ngày tải lên :
12/08/2014, 23:22
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine placenta ... representatives, the rabbit (Oryctolagus cuniculus), has an already sequenced genome, and can be reared and investigated easily at different stages of gestation, and has a placental physiology that has...
- 11
- 354
- 0
báo cáo khoa học: " Light has a specific role in modulating Arabidopsis gene expression at low temperature" potx
Ngày tải lên :
12/08/2014, 05:20
... At5 g63790 and ATAF2, At5 g08790), three AP2/ERF-domain proteins (At2 g23340, At5 g05410 and At4 g23750), five zinc finger proteins (At2 g47890, At5 g04340, At1 g06040, At1 g51700 and At5 g54470), a homeobox (At4 g08150), ... Ascorbate Reductase Genes At4 g35090 catalase (Up) At3 g09940 monodehydroascorbate reductase At3 g52880 monodehydroascorbate reductase At1 g20630 catalase (Down) At1 g75270 dehydroascorbate reductase At5 g03630 ... error of a mean (s.e., n = or 4) was calculated for each normalized ratio value presented in the Tables All original data containing normalized ratios of means, standard errors of the mean and t-test...
- 20
- 290
- 0
Students’ perceptions and practices of learner autonomy in learning english reading comprehension – an exploratory study at a private university in bac ninh province
Ngày tải lên :
19/07/2017, 19:26
... 3.1 Quantitative data .42 3.1.1 Data management and coding 42 3.1.2 Quantitative data analysis 44 3.2 Qualitative data .52 3.2.1 Data management and coding ... in- depth understanding of research problems by combining quantitative and qualitative data, and explaining the quantitative results in more detail with qualitative data The data collection instruments ... data to perform a quantitative analysis (called quantitizing) and conversion from quantitative data to perform a qualitative 31 analysis (called qualitizing) There is only one inference to make...
- 109
- 426
- 2
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
Ngày tải lên :
23/03/2014, 13:20
... maintains a blog at http://pankajghanshani.com, and you can follow him on Twitter at @PankajGhanshani and find him on Linkedin at http://www.linkedin.com /in/ pankajghanshani www.PacktPub.com Support ... can lead to an information gap that is readily filled by the grapevine This has created a new kind of challenge for managers—that of finding a reliable source of information and keeping an adequate ... Maslow and Mcclelland's theories of motivation We look at what is motivating in today's workplace and also what is de-motivating Finally, we peek into signs of low motivation that managers can...
- 328
- 4.5K
- 0
báo cáo khoa học: "A statistical model for genotype determination at a major locus in a progeny test design" ppt
Ngày tải lên :
09/08/2014, 22:22
... conditional on their genotypes -y,, is multinormal with - a mean I - variance-covariance matrix ’ a where Similarly, the vector and variance-covariance matrix of the mean R; , ; Y, of the ti’&dquo; and ... estimations of the parameters is defined in another way and calculate at each step the probability p, We, u) can be used in have to now, have : The we and probabilities ,n, We shall have a are ... evaluation and genetic trends In : Proc Anim Breed Genet Symp in honor of Dr J.L Lush, 10-41, American Society of Animal Science and American Dairy Science Associations, Champaign, Illinois ALOUEL...
- 16
- 364
- 0
Báo cáo y học: "Antiretroviral therapy at a district hospital in Ethiopia prevents death and tuberculosis in a cohort of HIV patients." ppt
Ngày tải lên :
10/08/2014, 05:20
... Chetchotisakd P, Tansuphaswaswadikul S, Bowonwatanuwong C: Opportunistic infections after the initiation of highly active antiretroviral therapy in advanced AIDS patients in an area with a high prevalence ... virologic and immunological end points found that HAART was equally effective in African patients [5] and challenged an earlier report that virological failure was more common in Africans [10] Page ... G, Vanacore P, Libanore M, Errante I, Matteelli A, Ippolito G, Angarano G, Babudieri S, Cancellieri C, Carbonara S, Chirianni A, Cingolani A, De Gennaro M, Giomi S, Lo Caputo S, Liuzzi G, Manzillo...
- 8
- 324
- 0
Báo cáo y học: "HIV, appendectomy and postoperative complications at a reference hospital in Northwest Tanzania: cross-sectional study" doc
Ngày tải lên :
10/08/2014, 05:21
... tertiary specialist care for a catchment population of approximately 13 million people from Mwanza, Mara, Kagera, Shinyanga, Tabora and Kigoma regions of Tanzania Study population We performed a ... hospital in northwest Tanzania Materials and methods Study area The study was conducted at Bugando Medical Centre (BMC) in Mwanza, north-western Tanzania This referral hospital is situated along ... not differ in patients with or without HAART Clinical, intraoperative and histological findings Table illustrates the clinical and intraoperative features observed in the study population with...
- 6
- 345
- 0
Báo cáo khoa học: " Yellow-necked mice (Apodemus flavicollis) and bank voles (Myodes glareolus) as zoomonitors of environmental contamination at a polluted area in Slovakia" doc
Ngày tải lên :
12/08/2014, 18:22
... Cd, lead (Pb), Cu and Zn, and the associated environmental contamination may increase the heavy metal content of mammals inhabiting the polluted areas In general, there is a significant relationship ... 186:1-10 Metcheva R, Teodorova S, Topashka-Ancheva M: A comparative analysis of the heavy metals and toxic elements loading indicated by small mammals in different Bulgarian regions Acta Zool Bulg ... expressed on a dry weight basis in mg.kg-1 Statistics From the final data, basic statistical characteristics were calculated (mean, standard deviation, minimum, maximum, median) Since the distribution...
- 5
- 161
- 0
Báo cáo y học: "Trauma admissions to the Intensive Care Unit at a reference Hospital in Northwestern Tanzania" ppsx
Ngày tải lên :
13/08/2014, 23:20
... analysis, manuscript writing & editing MM and JBM participated in data analysis and manuscript writing WM supervised the study and contributed in data analysis, manuscript writing & editing All ... contributed in study design, literature search, data analysis, manuscript writing & editing JMG and RMD participated in study design, data analysis, manuscript writing & editing MDM participated in data ... including Tanzania, injuries in general are increasing due to increase in urbanization, motorization, civil violence, wars and criminal activities [3] In these countries, major trauma remains a major...
- 18
- 288
- 0
a study on projection and its realization in president barack obama’s speech at a campaign event in las vegas
Ngày tải lên :
02/03/2015, 14:22
... between a dependent clause and its dominant clause In parataxis, clauses are independent of one another According to Halliday (1994:221), “the paratactic relation is logically symmetrical and transitive” ... two clauses are equal, Halliday & Matthiessen (2004: 374) calls relation “parataxis” in which one clause is initiating and the other continuing Contrary to “parataxis” is “hypotaxis”, the relation ... According to Halliday & Hasan (1985) cited in Martin & Rose (2007), mode refers to what part of language is playing and what the participants expect the language to for them in a certain situation The...
- 67
- 428
- 0
A study on the relationship between teaching and learning listening comprehension at a high school in Hoa Binh = Nghiên cứu về mối quan hệ giữa việc dạy và học
Ngày tải lên :
28/03/2015, 08:49
... lading to misunderstanding 13 Cognitive strategies such as rehearsal, organization, summarization, and elaboration are used to manipulate information Cognitive strategy is guessing the meaning ... performance was indicated Most teachers form expectations on the basis of appropriate information, such as cumulative folder data and change their expectations as student performance changes A minority ... communicating less warmth and affection to them Teachers who form expectations based on inappropriate data, are rigid and unchanging in their expectations, and treat low-expectation students in inhibiting...
- 96
- 545
- 1
A study on the teaching of reading skills to 10th form students at a High school in Ninh Binh = Nghiên cứu về việc dạy kỹ năng đọc hiểu cho học sinh lớp 10 ở mộ
Ngày tải lên :
28/03/2015, 08:51
... Also, Anderson(1984) states that the reason the students can not read adequately in English is that they can not read adequately in the native language Sharing the same view, Bernhardt and Kamil ... first and “listening to a worthwhile reading or dramatic presentation of what they have read.” (Rivers and Temperly,1978: 259) Lastly, that is integration of reading and speaking Reading materials ... process, and reading message are emphasized We find that there is a close relationship between reading and understanding Therefore, being a language teacher, we must understand the nature of reading...
- 82
- 1.2K
- 6
A study on the attitudes of 12th grade students in listenning lessons at a high school in Bac Ninh province = Nghiên cứu thái độ của học sinh lớp 12 trong
Ngày tải lên :
28/03/2015, 09:23
... receiving what the speaker actually says, constructing and representing meaning, negotiating meaning with the speaker and responding, and creating meaning through involvement, imagination and empathy ... motivated and enthusiastic in language learning Correspondingly, learners’ attitudes could incorporate in language learning Language teachers, researchers and students had better acknowledge that ... language attitude have been, therefore, indispensable in the field of language learning In the life of a language, attitudes to that language appear to be important in language restoration, preservation,...
- 74
- 541
- 0
Improving Grade 11 Students’ Reading Comprehension Skills through Focused Tasks at A High School in Nam Dinh = Nâng cao kỹ năng đọc hiểu cho học sinh lớp 1
Ngày tải lên :
28/03/2015, 10:26
... man from animals That is because language is an effective means of information, transaction and interaction making experience so we can say that without language there would be no civilization, ... Read the passage (TIENG ANH 11, 2007:167) and match the heading to the paragraphs Paragraph A The tragic accident Paragraph B The lift-off Paragraph C Congratulation Paragraph D A view on earth ... supporting details, extracting salient points to summarise, basic reference skills, skimming, scanning and transcoding information to diagrammatical display I.6.2.2 Questions and tasks in a reading...
- 60
- 573
- 0
SUMMARY OF THESIS IMPROVING GRADE 11 STUDENTS’ READING COMPREHENSION SKILLS THROUGH FOCUSED TASKS AT A HIGH SCHOOL IN NAM DINH
Ngày tải lên :
13/04/2015, 16:43
... AND FINDINGS III.1 Data analysis and findings In this part, the collected data will be illustrated on charts, tables and graphs Each chart, table or graph is followed by an analysis of the data ... Language distinguishes man from animals That is because language is an effective means of information, transaction and interaction making experience so we can say that without language there would ... in writing, speaking and listening I.2 Classification of reading I.2.1 Classification of reading according to manner According to manner, reading aloud and silent reading are two types of reading...
- 18
- 887
- 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM
Ngày tải lên :
10/07/2015, 14:50
... 3: Data analysis and findings 3.1 Coding and Analysis Similar to studies by Camiciottoli (2001) and Ro and Chen (2014), this study also applied a four -point response scale to analyze data from ... foreign language Reading in a Foreign Language, 25, 72–93 Eamin Ali Akanda, A K M., Hoq, K M G., & Hasan, N (2013) Reading habit of students in social sciences and arts: A case study of Rajshahi University ... read a “huge amount of very simple text so that [they] can read smoothly, confidently and pleasurably” Extensive reading is an approach to teaching and learning reading that uses reading materials...
- 63
- 587
- 1
A study on projection and its realization in President Barack Obama’s speech at a campaign event in Las Vegas
Ngày tải lên :
10/08/2015, 19:48
... Halliday, M .A. K & Hasan, R (1989) Language, Context, and Text: Aspects of Language in a Social-Semiotic Perspective Victoria: Deakin University Press Halliday, M A K Revised by Christian M I M Matthiessen ... Hanoi: Vietnam National University Nunan, D (1993) Discourse Analysis London: Penguin Group Richards et al (1992) Longman Dictionary of Language Teaching and Applied Linguistics London: Longman Thompson, ... functional grammar to discover new features of this innovative trend of grammar For the author, what attracts her the most is projection That is the reason why she chooses to analyze the realization...
- 3
- 258
- 1
NATURAL SELECTION ALONG AN ENVIRONMENTAL GRADIENT: A CLASSIC CLINE IN MOUSE PIGMENTATION
Ngày tải lên :
27/05/2016, 22:03
... environment and pigmentation remains untested and largely unexplained Although we believe that selection is the primary mechanism of coat color variation among populations, there is an alternative explanation: ... between beach and mainland forms Our approach also may be valuable in identifying any additional genes that contribute to naturally occurring variation in pigmentation (or other traits) Together, ... several genes—Sumner’s (1930) genetic analyses of this transect and Bowen and Dawson’s (1977) study of pigment pattern variation in natural populations each independently estimated that approximately...
- 16
- 473
- 0
DNA evidence is a frozen moment in time pdf
Ngày tải lên :
07/07/2014, 18:20
... •Ideal annealing temperature can be mathematically estimated It should be just 1-2 C below Tm Tm = (4 x [G+C]) + (2 x [A+ T]) • GATCTACCACTGATA ATACGTATCTAGTTA GCTCGGGGCATGCC DNA Quality DNA should ... should be intact and free of contaminants that inhibit amplification • Contaminants can be heme from blood, humic acid from soil and melanin from hair • Contaminants can be introduced during the ... of a DNA denaturation step, a primer annealing step and a primer extension step • DNA Denaturation: Expose the DNA template to high temperatures to separate the two DNA strands and allow access...
- 112
- 404
- 0