444 circuit with a static 1 hazard a logic diagram b timing diagram

Báo cáo y học: " Functional inhibition of NF-κB signal transduction in αvβ3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with a mutant IκB gene" ppsx

Ngày tải lên : 09/08/2014, 07:20

... minutes, and 30 µg was loaded on SDS-PAGE 10 % acrylamide gels followed by blotting to nitrocellulose membranes (BioRad Laboratories) The dnI B protein was detected using a rabbit anti-HA-tag antibody ... anti-human CD 31 (M0823, Dako) to detect CD 31 as a standard marker for endothelial cells, and mouse anti-rat ICAM -1 ( 1A2 9, kindly provided from Dr M Miyasaka, Osaka Univ., Osaka, Japan) as an iso-type ... stimuli Blood 20 01, 97 :16 11- 1 617 24 Yoshida A, Yoshida S, Ishibashi T, Kuwano M, Inomata H: Suppression of retinal neovascularization by the NF-kappa B inhibitor pyrrolidine dithiocarbamate in mice...

10
418
0

Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula ofﬁcinalis pptx

Ngày tải lên : 08/03/2014, 09:20

... 10 (E) ,12 (E)-tetradecadienoate by initial H-abstraction at C10 and 11 (E)-tetradecenoate to 9(Z) ,11 (E)-tetradecadienoate by initial oxidative attack at C9 [39] Whether these two transformations are catalyzed by separate ... Trans 1, 11 16 11 21 Ó FEBS 2002 19 Savile, C.K., Fabrias, G & Buist, P.H (20 01) Dihydroceramide D4 desaturase initiates substrate oxidation at C- J Am Chem Soc 12 3, 4382–4385 20 Fauconnot, L & Buist, ... of related FAD2-like enzymes [7] involved in the formation of a- eleostearic acid [9(Z) ,11 (E) ,13 (E)-octadecatrienoic acid] and a- parinaric acid [9(Z) ,11 (E) ,13 (E) ,15 (Z)-octadecatetraenoic acid]...

6
341
0

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Ngày tải lên : 08/03/2014, 09:20

... 10 0 11 1 16 Rajan, R., Awasthi, S.K., Bhattachajya, S & Balaram, P (19 97) ÔTeflon-coated peptidesÕ: hexafluoroacetone trihydrate as a structure stabilizer for peptides Biopolymers 42, 12 5 12 8 17 Atherton, ... HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab- (1 42) better than all other media and, at the same time, it has a helix-promoting ability very similar to ... Teplow, D .B (20 01) Identification and characterization of key kinetic intermediates in amyloid b- protein fibrillogenesis J Mol Biol 312 , 11 03 11 19 12 Coles, M., Bicknell, W., Watson, A. A., Fairlie,...

7
624
0

Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx

Ngày tải lên : 14/03/2014, 13:20

... be a sequence of i.i.d random variables each taking values 0, 1, ∞ n with equal probability 1/ 3 Let S = n =1 3−n Xn , Sn = i =1 3−i Xi be the n-partial sum of S, and let µ, µn be the probability ... Nguyen, Local dimensions of fractal probability measures associated with equal probability weight, Preprint T Hu, N Nguyen and T Wang, Local dimensions of the probability measure associated with the ... log √ (14 ) # s2n +1 , √ n+2 (a1 − an+2 )3−2n | log a1 =1 2(n) log log (15 ) Combinating (14 ) and (15 ) we get α 1 Therefore log a1 log √ log (1 + 5) − log log a1 α =1 =1 log log The claim is...

14
387
0

Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Ngày tải lên : 16/03/2014, 14:20

... recognition of both starch and pullulan as a substrate Structural comparison of the catalytic site between TVAI and other a- amylases Since pullulan with regular repeats of a- (1, 6), a- (1, 4), and a- (1, 4) ... Minamiura N & Imanaka T (19 92) Action of neopullulanase Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 ﬁ 4)- and a- (1 ﬁ 6)-glucosidic linkages J Biol Chem 267, 18 447 18 452 11 ... vulgaris R-47 Biochem Biophys Acta 12 52, 35–42 Ibuka A, Tonozuka T, Matsuzawa H & Sakai H (19 98) Conversion of neopullulanase -a- amylase from Thermoactinomyces vulgaris R-47 into an amylopullulanase-type...

9
342
0

Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulﬁde linkage pdf

Ngày tải lên : 30/03/2014, 09:20

... outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0 .16 A and a ˚ mean global heavy atom rmsd of 1. 30 ± 0.28 A Structural reﬁnement was carried out using amber and structure quality ... global backbone rmsd of 0.56 ± 0 .16 A and a ˚ mean global heavy atom rmsd of 1. 30 ± 0.28 A Finally, reﬁnement of the structure was carried out using amber [12 ] for energy minimization An ensemble ... Cys15 were added to the distance constraints for primary structure determination A set of 20 structures was generated with a mean global ˚ rmsd of 1. 88 A using the dyana (v 1. 5) [11 ] software package...

7
346
0

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Ngày tải lên : 31/03/2014, 23:20

... normal rabbit IgG; lane 3, ipp with aF-N without competitors; and with competitors, lanes 4, and 6, with C8; lanes 7, and 9, with C5; lanes 10 , 11 and 12 , with C5Pc-2; lanes 13 , 14 and 15 , with ... isolate a full-length mLRP130 cDNA, · 10 6 plaques of an NIH3T3 cDNA library in kZAP II (Stratagene) were screened by plaque hybridization [ 31] using pE Cl as a probe A probe was labeled with [a- 32P]dCTP ... minisatellite Pc -1 binding proteins Biochim Biophys Acta, 15 2 p, 15 2 15 8 24 Katahira, M., Fukuda, H., Kawasumi, H., Sugimura, T., Nakagama, H & Nagao, M (19 99) Intramolecular quadruplex formation...

7
305
0

Báo cáo " Tổng hợp và nghiên cứu một số N-Aryliđen[5-(menthoximettyl)-4-phenyl-1,2,4-triazole-3-ylsunfanyl]a xetohiđrazit" ppt

Ngày tải lên : 03/04/2014, 15:20

6
269
0

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Ngày tải lên : 20/06/2014, 01:20

... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18 S rRNA-f (5'-actcaacacgggaaacctca-3') and 18 S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18 S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... interacts with and stabilizes the cell cycle regulator cyclin D3 J Virol 19 97, 71: 7328-7336 Tanaka M, Kagawa H, Yamanashi Y, Sata T, Kawaguchi Y: Construction of an excisable bacterial artificial...

13
463
0

§ 2. DÃY SỐ CÁCH ĐỀU Bài 1: Cho dãy số 2, 4, 6, 8, ..., 2006. a) Dãy này có bao docx

Ngày tải lên : 21/06/2014, 03:20

... hạng thứ 21 ( 21 – 1) + 10 1 = 16 1 Vậy chữ số cần tìm chữ số B i 12 : Tính tổng S = 10 , 11 + 11 , 12 + 12 , 13 + … + 98, 99 + 99, 10 0 Hd: S = (10 + 11 + 12 + … + 98 + 99) + (0, 10 + 0, 11 + 0, 12 + … ... dãy s 10 0, 10 2, …, 13 8 10 8 Vậy chữ số cần tìm b) Số số hạng dãy (13 8 – 10 ) : + = 65 Vậy 10 + 12 + 14 + … + 13 8 = (10 + 13 8) 65 : = 4 810 B i 7: Cho dãy số 10 1, 10 2, 10 3, …, 10 00, 10 01, , 2005 a) ... thứ 13 6 phải nằm dãy số 10 1, 10 3, … ,17 5 Chữ số thứ 13 6 dãy số 11 , 13 , 15 , , 17 5 chữ số thứ 13 6 – 90 = 46 dãy số 10 1, 10 3, …, 17 5 + Ta có: 46 : = 15 (dư 1) + Tìm số hạng thứ 16 dãy số 10 1, 10 3,...

12
1.3K
3

Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc

Ngày tải lên : 22/06/2014, 18:20

... and a = {am }∞ =1 ∈ l p , b = m ∞ {bn }n =1 ∈ l q , and a p , b q > 0, T is deﬁned by (1. 1), and the formal inner product of Ta and b is deﬁned by ∞ (Ta ,b) := ∞ k(m,n)am bn = (a, Tb), n =1 m =1 (1. 7) ... ∞ am bn m+n n =1 m =1 ∞ b 2; ∞ ln(m/n)am bn < π2 a m−n n =1 m =1 ∞ b 2; (3.20) ∞ am bn max {m,n} n =1 m =1 b References [1] B Yang, “On the norm of a Hilbert’s type linear operator and applications,” ... 3 21, no 1, pp 18 2 19 2, 2006 [4] B Yang, “On the norm of a self-adjoint operator and a new bilinear integral inequality,” Acta Mathematica Sinica, vol 23, no 7, pp 13 11 13 16, 2007 ´ e [5] A B ...

9
334
0

Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

Ngày tải lên : 06/07/2014, 20:20

... cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: A dilated, superficial blood vessel ... Such lesions usually demonstrate asymmetry, border irregularity, color variegation (black, blue, brown, pink, and white), a diameter >6 mm, and a history of change (e.g., an increase in size or ... interpretation would be that the patient has a pruritic eczematous dermatitis with erosions caused by scratching Figure 52 -1 Superficial spreading melanoma This is the most common type of melanoma Such...

5
413
0

Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc

Ngày tải lên : 06/07/2014, 20:20

... red papules on the lower extremities that blanch with pressure can be a manifestation of many different diseases, but hemorrhagic red papules that not blanch with pressure indicate palpable purpura ... usually advisable to assess the patient before taking an extensive history This way, the entire cutaneous surface is sure to be evaluated, and objective findings can be integrated with relevant ... individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous membranes of the mouth, eyes, nose, nasopharynx,...

5
414
0

start with E tuan 1-4

Ngày tải lên : 12/07/2014, 03:00

... practice reading with partners Consolidatio n (10 ’) Homework (3’) Play a game: Playing game to practice more about the vocabulary “hangman” T has Ss read all the words and practice reading at home ... the papers T hands in the papers and gives marks T hands out then remarks Consolidatio n (10 ’) Play a game: Playing game to practice more about the vocabulary “hangman”( apples) -whole class T-whole ... practice more about the vocabulary “jumble words” Tna=ant ; kobo= book; plape= apple; pca= cap;reteh=three; wot=two; neo=one … T has Ss read all the words and practice reading at -whole class...

9
272
0

Giáo án âm nhạc lớp 4: Học bài hát: A LÊ (tiết 1) docx

Ngày tải lên : 23/07/2014, 13:22

... dẫn học sinh v a đọc v a vỗ tay theo tiết tấu lời ca câu B t nhịp cho lớp v a đọc v a vỗ tay theo tiết tấu lời ca Chia lớp thành nhóm, Hoạt động học sinh 1- 3 học sinh đọc Tập vỗ tay theo hướng ... Đàn ghi ta tranh vẽ đàn ghi ta, b ng nhạc tiếng đàn ghi ta Thời gian Hoạt động giáo viên a) Hoạt đông 1: Giới thiệu đàn ghi ta: Gọi học sinh đọc phần giới thiệu đàn ghi ta sách giáo khoa Giáo viên ... ca b) Hoạt đông 2: Tập hát lời 1: Giáo viên hát mẫu tập hát câu cho học sinh, lời hát Cả lớp tập hát tưng câu chia thành câu sau: Các nhóm hát Câu 1: A Lê săn le le, b n l a gập đôi Câu 2: A...

7
1.5K
2

Giáo án tiếng anh lớp 5 - UNIT 4 SCHOOL ACTIVITIES Section A (1, 2, 3) Period 17 doc

Ngày tải lên : 23/07/2014, 15:20

... times) Look and say T ask- Ss answer Guide Ss to say follow structures:Line A ask- Line B answer then change What are you doing? Then Ss practice to say in pair I’m reading a book A: What are you ... pair c- Post-listen Some pairs practice to talk Call some Ss read again Two or four Ss read in front of t class Other listen carefully and remar Look and say Activity3 (10 ’) - read follow teacher ... old When was you born? It’s in (May) Activity 2:( 10 ’) I was born on 24th, March, 2000 1. Look, listen and repeat 1. Look, listen and repe a- Pre listen T says about the situation in the dialogue...

6
1.4K
0

learning with a difference - Hidden pictures 4 ppsx

Ngày tải lên : 26/07/2014, 13:20

66
1.1K
7

Báo cáo khoa học: "Pim-1 A serine/threonine kinase with a role in cell survival, proliferation, differentiation and tumorigenesis" potx

Ngày tải lên : 07/08/2014, 15:20

13
305
0

Working with a study budy 1 pot

Ngày tải lên : 07/08/2014, 22:20

... suitable for the way you learn Be aware of what works best for you and make changes if necessary (You may want to review Chapters through on learning styles.) START WITH THE POSITIVE Begin a session ... don’t have anyone whom with to share ideas and interpretations, or to exchange questions and answers? You can treat yourself as your own buddy! 17 B EING Y OUR O WN PARTNER M any students say what ... session by asking yourself what you liked about what you read, wrote, saw, or heard Starting out with something you enjoy and feel comfortable with will give you a sense of accomplishment as you say...

6
288
0

Working with a study budy 4 pps

Ngày tải lên : 07/08/2014, 22:20

... you made and take each other’s test Make sure you each have an answer sheet that includes page numbers that indicate where the answers can be found in your class material TIME MANAGEMENT You want ... the barber shop, a newspaper on your way to work, a message on the TV screen—choose a word that seems important in a particular sentence Create an association with that word, something that will ... no matter what job she is doing, is more apt to well In the sentence above, cognizant most nearly means a proud b aware c highly knowledgeable d automated Making an Educated Guess Use your learning...

6
306
0

444 circuit with a static 1 hazard a logic diagram b timing diagram

Báo cáo y học: " Functional inhibition of NF-κB signal transduction in αvβ3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with a mutant IκB gene" ppsx

Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula ofﬁcinalis pptx

444 circuit with a static 1 hazard a logic diagram b timing diagram