3 the inlet and exit path of fluid inside the md module are specially located to reduce the heat loss between the membrane and the hot feed and provide better mixing of the feed the feed entrance was placed at a close proximity o
Conversion of saline water to fresh water using air gap membrane distillation (AGMD)
Ngày tải lên :
11/09/2015, 09:57
... 74 3. 1 .3. 5 .Heat transfer during condensation 75 3. 1 .3. 6 .Heat transfer through coolant plate and coolant 83 3.2 Practical application of MD using waste heat from engine cooling water 84 cooling ... program for 2-D evaporation model 71 Figure 3. 8 Heat transfer from hot feed to coolant through evaporation, 72 conduction and condensation Figure 3. 9 Condensation process on the coolant plate ... requires a heat source to maintain feedwater temperature The salient features of the AD cycles are (i) the utilization of low temperature waste heat, (ii) no major moving parts, and (iii) utilization...
- 248
- 646
- 0
Báo cáo hóa học: " Global attractor of the extended FisherKolmogorov equation in Hk spaces" pot
Ngày tải lên :
20/06/2014, 22:20
... existence of global attractors of the extended Fisher-Kolmogorov equation (1.1) in any kth-order space Hk Theorem 3. 2 For any a ≥ the extended Fisher-Kolmogorov equation (1.1) has a global attractor A ... Ha We first consider the case of α = From Theorem 3. 1 we have known that the extended Fisher-Kolmogorov equation possesses a global attractor in H space, and the global attractor of this equation ... attractor A ⊂ X which attracts any bounded set of X, where DF is a derivative operator of F, and b1, b2, C1, C2 are positive constants For sectorial operators, we also have the following properties...
- 10
- 314
- 0
THE COMPLEX MONGEAMPERE EQUATION IN ` DOMAIN OF C n
Ngày tải lên :
14/10/2015, 08:01
... pertaining to the plurifine topology are indicated with the prefix F and notions pertaining to the fine topology are indicated with Cn For a set A ⊂ Cn we write A F for the closure of A in the one point ... point compactification of Cn , A for the Fclosure of A and ∂F A for the F-boundary of A We denote by F-P SH(Ω) the set of F-plurisubharmonic functions on an F-open set Ω We say that u is F-maximal ... )n The proof is complete We now give the proof of Theorem 1.1 Proof of Theorem 1.1 We consider two cases Case µ is carried by pluripolar set of Ω Choose {aj } ⊂ Ω and {rj } of positive real number...
- 8
- 179
- 0
Tài liệu Đề tài " Global well-posedness and scattering for the energy-critical nonlinear Schr¨odinger equation in R3 " docx
Ngày tải lên :
16/02/2014, 06:20
... large amount of energy away from the concentration point, and then use approximate finite speed of propagation to decouple the solution into two nearly noninteracting components of strictly smaller ... the propagator eitΔ , and conjugation operations, are self-adjoint, and are bounded on every Lebesgue space Lp and Sobolev space ˙ H s (if ≤ p ≤ ∞, of course) Furthermore, they obey the following ... is proven in Section The proof follows a similar strategy to that used to prove Proposition 4 .3; the main difference is that we now consider spatially separated components of u rather than frequency...
- 100
- 434
- 0
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx
Ngày tải lên :
19/02/2014, 06:20
... ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC AAAGATCTGCCGACCTACCATAGCGGTC ATGTTAATTGTAACGGCATCGATGAATT CGAGCTCG TTCGAAAAATGCAGCATT TCTACAAAAGCCCTCCTACC CCAGGAGAGAATTCAAGTATTGC B C ALR1 ALR-c36 ... (5¢) to 3 ) A AAAGCGACTAGTCATTTTACCATG TGTTTCGTCGACGCAAGAAGCTCG TTCTGTCGACCCAATAGCTGG ATTAATCCGGTCGACTAACATTCATACC TTAAAGTCGACCTAAGTAGTTTGTATGG AAAGTCGACTGTCGTAGCGGC B1-linker-ATGTCATCATCCTCAAGTTC ... ATTGCAGTTGTCC ATGCGGCCGCGTCGACGATTGTAACG TTTCTGCAGGAGCTCGAAAAATGCA GCATTTGG AAACTGCAGGATTGTAACGGCTATAT CTAC CAGGGTATGGATGAAACGGTTGC TGATCCCGAAGTGGAAGTAGAGC TTAAGTTCTAATGCGAGGCCATCC TTCGTTCACTGTGCCTTTGATGG...
- 14
- 607
- 0
Tài liệu Báo cáo khoa học: Hyperactive antifreeze protein in flounder species The sole freeze protectant in American plaice docx
Ngày tải lên :
20/02/2014, 01:20
... 60–65% of the compositions of 5a and 5a- like protein and 55% of ApAFP Of the other amino acids, Thr ( 13% ) is the next most abundant, and there are very low amounts of aromatic and longchain aliphatic ... mgÆmL)1 BSA Data points are the average of at least two readings Inset is an expansion of the data points for the low concentration readings chromatography steps to avoid procedures that resulted ... (A) Fractionation of American plaice plasma on a Sephadex G-75 column (B) Refractionation of pooled active AFP fractions from (A) on Sephadex G-75 Absorbance at 230 nm (black dot) and thermal...
- 11
- 469
- 0
Tài liệu Báo cáo khoa học: Reconstitution of coupled fumarate respiration in liposomes by incorporating the electron transport enzymes isolated from Wolinella succinogenes docx
Ngày tải lên :
21/02/2014, 03:20
... for preparation was incorporated into the proteoliposomes [30 ] (data not shown) The molar ratio of the two enzymes was close to that of the bacterial membrane The enzyme contents based on phospholipid ... the proteoliposomes prepared at the critical or lower ratios, whereas 30 35% of the hydrogenase molecules are oriented to the inside of proteoliposomes obtained at the highest ratios It was not ... fumarate respiration [35 ] Furthermore, the standard potential of MK/MKH2 in a bacterial membrane was measured to be close to that in organic solution [36 ] Therefore, the actual H+/e ratio of...
- 10
- 569
- 0
Báo cáo khoa học: Isothermal unfolding studies on the apo and holo forms of Plasmodium falciparum acyl carrier protein Role of the 4¢-phosphopantetheine group in the stability of the holo form of Plasmodium falciparum acyl carrier protein docx
Ngày tải lên :
16/03/2014, 10:20
... Separation of apo-ACP and holo-ACP; 12% native PAGE showing the separation of apo-ACP and holo-ACP by anion exchange chromatography Lane 1: mixture of apo-ACP and holo-ACP Lane 2: puried apo-ACP ... His-tag (F) Separation of apo-ACP and holo-ACP by anion exchange chromatography Elution prole of apo-ACP and holo-ACP on a MonoQ HR anion exchange column Peak 1: apo-ACP Peak 2: holo-ACP (G) Separation ... holo-ACP dimer Peak 2: mixture of apo-ACP and holo-ACP monomers (D) Separation prole of holo-ACP dimer and apo-ACP and holo-ACP monomers: 12% native PAGE showing the separation of holo-ACP dimer...
- 14
- 419
- 0
Báo cáo "Quantum kinetic equation in the quantum hadrondynamics (QHD-I) model " pptx
Ngày tải lên :
22/03/2014, 11:20
... in real-time and clearly establishes the relation between the interaction rate in the relaxation time approximation and the damping rate of the mean field Discussion and conclusion In the above ... The Feynman diagrams contribute to the kinetic equation for fermion’s interaction up to two loop order The bold solid line is the fermion propagator S, the only solid line is the scalar propagator ... Laboratories for Fundamental Physics, University of Chicago Press (1996) [5] D Boyanovsky, H.J de Vega, S.Y.Wang, Dynamical Renormalization Group Approach to Quantum Kinetics in Scalar and Gauge...
- 10
- 165
- 0
steinmetz cp discussion on 'the effect of iron in distorting alternating-current wave-form
Ngày tải lên :
04/06/2014, 12:44
... equations I not consider the parabolic law of magnetic induction: H B-Il a+ bH as an empirical law, however, but rather as a rational equation approximating the B-H curve, and the deviations of the induction ... first place I want to call attention to the use of the word' sinusoidal." In the study of mechanics the word " harmonic" has come into almost universal use for designating that type of motion which ... resistance of the circuit between generator and sample was about 0.75 ohm, of which 0 .3 ohm was in the instruments in the circuit and 0.45 in the step-down transfomer (one-half a kilowatt, 20 to ratio)...
- 20
- 439
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
Ngày tải lên :
20/06/2014, 22:20
... Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl 184, 431 – 436 (1994) doi:10.1006/jmaa.1994.1211 Skof, F: Local properties and approximation of operators Rend Sem Mat ... (NRF-2010-00 132 11) Author details Department of Mathematics, College of Sciences, Yasouj University, Yasouj 75914 -35 3, Iran 2Department of Mathematics, University of Ulsan, Ulsan 680-749, Korea 3Department of ... http://www.fixedpointtheoryandapplications.com/content/2011/1/67 Page 11 of 14 for all x Î X and t >0 Proof The proof is similar to the proof of Theorem 4.1 □ Corollary 4.2 Let X be a real normed space, θ ≥ and let p be a real...
- 14
- 479
- 0
Báo cáo hóa học: " On the stability of an AQCQ-functional equation in random normed spaces" potx
Ngày tải lên :
21/06/2014, 01:20
... stability for a mixed type of quartic and quadratic functional equation Park et al Journal of Inequalities and Applications 2011, 2011 :34 http://www.journalofinequalitiesandapplications.com/content/2011/1 /34 ... functional equation In particular, every solution of the quadratic functional equation (1.1) is said to be a quadratic mapping It is well known that a mapping f between real vector spaces is quadratic ... doi:10.1006/jath.19 93. 1010 Rassias, ThM: On the stability of functional equations and a problem of Ulam Acta Math Appl 62, 23 130 (2000) doi:10.10 23/ A: 10064992 235 72 Rassias, ThM: On the stability of functional...
- 12
- 395
- 0
báo cáo hóa học: " On the stability of pexider functional equation in non-archimedean spaces" pot
Ngày tải lên :
21/06/2014, 02:20
... space to a non-Archimedean space is constant This is a consequence of totally disconnectedness of every non-Archimedean space (see [ 23] ) Saadati et al Journal of Inequalities and Applications ... http://www.journalofinequalitiesandapplications.com/content/2011/1/17 Page of 11 Stability of quadratic and Cauchy functional equations Throughout this section, we assume that V1 is a normed space and ... proves Equation 3. 3 Similarly, one can prove Equations 3. 4 to 3. 6 Acknowledgements The authors would like to thank the referee and area editor Professor Ondrĕj Došlý for giving useful suggestions...
- 11
- 325
- 0
báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx
Ngày tải lên :
21/06/2014, 02:20
... > The function F is now related to the evolution of the temperature instead of the heat flux at x = The problem (P6) can be considered a non-classical moving boundary problem for the heat equation ... non-classical heat equation in the slab [0,1] with a heat source depending on the heat flux (or the temperature) on the boundary x = Moreover, a generalization for non-classical moving boundary ... system of temperature regulation in isotropic media and the source term in (1.1) describes a cooling or heating effect depending on the properties of F which are related to the evolution of the heat...
- 17
- 520
- 0
Báo cáo hóa học: " Study of the vertical transport in p-doped superlattices based on group III-V semiconductors" pdf
Ngày tải lên :
21/06/2014, 05:20
... energy was considered at the top of the Coulomb potential at the barrier Horizontal dashed lines indicate the bottom of the first miniband and the top of the second miniband, respectively EF crosses ... These effects are responsible for changes in the bending of the potential profiles The bending is repulsive particularly for this Page of case of GaAs/AlGaAs, and so the Coulomb potential stands ... (6) The parameters used in these calculations are the same as those used in our previous studies [11- 13] In the above calculations, 40% for the valence-band offset and relaxation time τ = ps has...
- 6
- 360
- 0
Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt
Ngày tải lên :
21/06/2014, 20:20
... i=1 as the equation for the spaces of generalized functions Using the fundamental solution of the heat equation, we solve the general solution and prove the Hyers– Ulam stability of this equation ... M, Kaboli Gharetapeh, S, Moslehian MS, Zolfaghari, S: Stability of a Mixed Type Additive, Quadratic, Cubic and Quartic Functional Equation Nonlinear Analysis and Variational Problems, vol 35 , ... Kannappan, Pl, Sahoo, PK: On generalizations of the Pompeiu functional equation Int J Math Math Sci 21, 117–124 (1998) [ 13] Najati, A, Eskandani, GZ: A fixed point method to the generalized stability...
- 21
- 299
- 0
Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx
Ngày tải lên :
22/06/2014, 02:20
... Inequalities and Applications S.-D Wang, T.-S Kuo, and C.-F Hsu, “Trace bounds on the solution of the algebraic matrix Riccati and Lyapunov equation,” IEEE Transactions on Automatic Control, vol 31 , no ... researchers to evaluate the bounds and trace bounds for the solution of the ARE 6–12 In addition, from 2, , we know that an interpretation of tr K is that tr K /n is the average value of the optimal ... give two examples to illustrate that our new trace bounds are better than the recent results Then, to illustrate the application in the algebraic Riccati Journal of Inequalities and Applications...
- 18
- 456
- 0
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx
Ngày tải lên :
22/06/2014, 02:20
... Mathematics, vol 27, no 3- 4, pp 36 8 37 2, 1995 16 S.-M Jung, “On the Hyers-Ulam stability of the functional equations that have the quadratic property,” Journal of Mathematical Analysis and Applications, ... Aequationes Mathematicae, vol 65, no 3, pp 267–279, 20 03 S.-Y Chung, “Reformulation of some functional equations in the space of Gevrey distributions and regularity of solutions,” Aequationes Mathematicae, ... stability of 1.1 on restricted domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality...
- 12
- 311
- 0
Báo cáo hóa học: " Research Article Stability of Cubic Functional Equation in the Spaces of Generalized Functions" potx
Ngày tải lên :
22/06/2014, 18:20
... Journal of Mathematical Analysis and Applications, vol 251, no 1, pp 264–284, 2000 [12] Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... pp 433 –4 43, 2006 [5] P G˘ vruta, A generalization of the Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, ... Euler-Lagrange quadratic mappings,” Journal of Mathematical Analysis and Applications, vol 220, no 2, pp 6 13 639 , 1998 [11] Th M Rassias, “On the stability of functional equations in Banach spaces,”...
- 13
- 371
- 0
