3 4 10 transferring to in out parameters of a function block

Bài 3,4 Các nguyên tố hóa học và nước - Cacbohđrat và Lipit

Bài 3,4 Các nguyên tố hóa học và nước - Cacbohđrat và Lipit

... ơstrôgen, testostêrôn - Sắc tố vitamin: Carôtenôit, vitamin A, D, E, K… 2) Chức năng: - Cấu trúc nên hệ thống màng sinh học - Nguồn lượng dự trữ - Tham gia nhiều chức sinh học khác 4. Củng cố: - ... Sinh học 10 III CACBOHYĐRAT: (Đường) 1, Cấu trúc hoá học: a) Đường đơn: (monosaccarit) - Gồm loại đường có từ 3- 7 nguyên tử C - Đường C (Ribôzơ,đeôxyribôzơ), đường C (Glucôzơ, Fructôzơ, Galactôzơ) ... gồm ptử glucôzơ ptử galactôzơ c) Đường a: (polisaccarit) - Gồm nhiều phân tử đường đơn liên kết với liên kết glucôzit - Glicôgen, tinh bột, xenlulôzơ, kitin… 2, Chức Cacbohyđrat: - Là ngồn cung...

Ngày tải lên: 20/09/2013, 23:10

2 1,4K 3
Báo cáo khoa học: Phosphatidylinositol 3,4,5-trisphosphate modulation in SHIP2-deficient mouse embryonic fibroblasts pot

Báo cáo khoa học: Phosphatidylinositol 3,4,5-trisphosphate modulation in SHIP2-deficient mouse embryonic fibroblasts pot

... 22 23 nantly regulates Akt2, and not Akt1, phosphorylation at the plasma membrane in response to insulin in 3T3-L1 adipocytes J Biol Chem 279, 14 835 – 148 43 Hori H, Sasaoka T, Ishihara H, Wada T, ... SH2-containing inositol phosphatase results in negative regulation of insulin-induced metabolic actions in 3T3-L1 adipocytes via its 5¢-phosphatase catalytic activity Mol Cell Biol 21, 1 633 –1 646 Sasaoka ... associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3, 4, 5- triphosphate 5-phosphatase Proc Natl Acad Sci USA 93, 1689–16 93 Ishihara H, Sasaoka T, Hori...

Ngày tải lên: 16/03/2014, 19:20

11 303 0
Báo cáo y học: "Divergent expression of claudin -1, -3, -4, -5 and -7 in developing human lung" potx

Báo cáo y học: "Divergent expression of claudin -1, -3, -4, -5 and -7 in developing human lung" potx

... GACAAGCTTCCCGTTCTCAG claudin CCGGCGACAACATCGTGAC CGGGTTGCTTGCAATGTGC claudin CGCGAGAAGAAGTACACGG CCTTAGACGTAGTCCTTGCGG claudin CGCATCAGGACTGGCTTTATCTC CAGCGCGATGCCCATTA Kaarteenaho et al Respiratory Research ... 23 24 26 26 28 28 30 30 35 35 35 39 40 41 42 A dult* 13 13 16 16 20 20 20 22 23 24 26 26 28 28 30 30 35 35 35 39 40 41 42 Adult* W eeks 13 13 16 16 20 20 20 22 23 24 26 26 28 28 30 30 35 35 35 ... of claudin -4 RNA was observed to decline in saccular period (Mean 2 .49 , SD 0.87) and it then appeared to stay at that level until week 42 (mean 3. 53, SD 1. 83) Amounts of RNAs of claudins 1, and...

Ngày tải lên: 12/08/2014, 11:22

10 319 0
skkn một số biện pháp tạo hứng thú cho trẻ 3 + 4 tuổi khi tổ chức hoạt động ngoài trời

skkn một số biện pháp tạo hứng thú cho trẻ 3 + 4 tuổi khi tổ chức hoạt động ngoài trời

... SL % SL % Đạt yêu cầu SL % 20 131 0 100 30 17 10 33 15 50 20 14 30 Kỳ I 20 141 0 100 30 90 15 50 10 33 17 2015 So sánh thống kê với bảng thống kê điều tra thực trạng ta thấy mức độ hứng thú trẻ nâng ... lớp khác Cụ thể sau: Lớp M a hè M a đông Nhà trẻ 8h35 – 9h05 8h45 – 9h15 Mẫu giáo bé 8h45 – 9h15 9h00 – 9h30 Mẫu giáo nhỡ 9h40 – 10h10 9h55 – 10h25 Mẫu giáo lớn 9h45 – 10h15 3. 2 Xây dựng môi ... “Trốn m a , vẽ m a theo âm to nhỏ cảnh vật m a hành lang, trẻ hứng thú 3. 3.2 Khai thác môi trường sẵn có để l a chọn tổ chức hoạt động trời cho trẻ Như biết trẻ mầm non việc “Học gì?” không quan trọng...

Ngày tải lên: 26/07/2016, 14:09

26 1,4K 1
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

... and then gradually increased up to 10 h, when maximal incorporation was attained This was followed by a decrease Under hypoxia, in contrast, incorporation decreased to a background level during ... normoxic gassing first mitotic cells appear after about 13 h, their number increases within the next h and decreases again at longer incubation A similar increase of DNA synthesis occurs in the same ... nuclear fraction containing the cellular DNA and proteins associated with replicating chromatin We take this material as a functional equivalent to SV40 minichromosomes elutable from the nuclei of virus...

Ngày tải lên: 21/02/2014, 00:20

11 610 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... isolate Moravia/Ma 530 2V/ 94 (or TULV02, for short) [18], nt 36 9–18 53 originate from the strain Tula/Ma 23/ 87 [19], and nt 33 3 36 8, that are identical in both variants, can be of either origin Both ... VF 738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738 –760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831 –855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF 738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... U -A G-C U -A A-U G-C U:G U -A C U C-G U -A GGAAAUG GCCAAGU 33 7 38 1 http://www.virologyj.com/content/2/1/12 (-) sense G C A A-U U -A U -A C C A- U C-G A- U U -A C-G A C A- U G A G-C A- U CCUUUAC CGGUUCA...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

... isolate Moravia/Ma 530 2V/ 94 (or TULV02, for short) [18], nt 36 9–18 53 originate from the strain Tula/Ma 23/ 87 [19], and nt 33 3 36 8, that are identical in both variants, can be of either origin Both ... VF 738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738 –760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831 –855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF 738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... U -A G-C U -A A-U G-C U:G U -A C U C-G U -A GGAAAUG GCCAAGU 33 7 38 1 http://www.virologyj.com/content/2/1/12 (-) sense G C A A-U U -A U -A C C A- U C-G A- U U -A C-G A C A- U G A G-C A- U CCUUUAC CGGUUCA...

Ngày tải lên: 20/06/2014, 04:20

5 430 0
Báo cáo toán học: "OXIDATIVE PHOSPHORYLATION: Kinetic and Thermodynamic Correlation between Electron Flow, Proton Translocation, Oxygen Consumption and ATP Synthesis under Close to In Vivo Concentrations of Oxygen" docx

Báo cáo toán học: "OXIDATIVE PHOSPHORYLATION: Kinetic and Thermodynamic Correlation between Electron Flow, Proton Translocation, Oxygen Consumption and ATP Synthesis under Close to In Vivo Concentrations of Oxygen" docx

... Fourth, to 10 μl of standard medium containing from to 40 0 nmols of ADP were added into the cell and the system again incubated until the O2 and ATP (contaminating the sample of ADP) added Oxygen ... Experimental Procedures The experiment was initiated by adding 40 0 nmols of ADP and 6 .3 nmols of ATP (as contaminant of ADP) to an air-saturated medium free from RLM and succinate After 1.5 of incubation, ... coupling in oxidative phosphorylation based on a molecular explanation of the oxygen exchange reactions Proc Natl Acad Sci USA 19 73; 70: 2 837 -39 Kayalar C, Rosing J and Boyer PD An alternating...

Ngày tải lên: 08/08/2014, 17:20

9 211 0
báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx

báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx

... anterior gastrostomy (Figure 3) to ensure drainage from his stomach His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojejunostomy and a drain by the ... duodenal laceration following minor blunt abdominal trauma in the presence of a large pancreatic pseudocyst Minor blunt abdominal trauma in a normal healthy adult would not be expected to result in ... fistulas and intraabdominal abscesses were the main causes of morbidity [3] Most duodenal injuries can be managed by surgical repair [3] Non-operative management of duodenal perforations with intravenous...

Ngày tải lên: 10/08/2014, 23:20

4 251 0
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx

A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx

... 2008, 3: 51 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Browman GP, Snider A, Ellis P: Negotiating for change The healthcare manager as catalyst for evidence-based practice: ... for innovation in teams Economic and Industrial Democracy 20 04, 25 :30 1 -31 8 Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators Academy of management ... evidence-based nursing Canadian Journal of Nursing Leadership 2000, 13: 31 -37 Estabrooks C: Translating research into practice: Implications for organizations and administrators Canadian Journal of Nursing...

Ngày tải lên: 11/08/2014, 05:21

10 521 0
báo cáo khoa học: "A trial platform to develop a tailored theory-based intervention to improve professional practice in the disclosure of a diagnosis of dementia: Study protocol [ISRCTN15871014]" potx

báo cáo khoa học: "A trial platform to develop a tailored theory-based intervention to improve professional practice in the disclosure of a diagnosis of dementia: Study protocol [ISRCTN15871014]" potx

... clinical area of dementia we have conducted a systematic review that indicates wide variation in the reported practice of disclosure of dementia among health professionals [3] Four main factors appear ... finding that changing clinical practice is unpredictable and can be a slow and haphazard process Over the last decade a considerable body of literature has been published suggesting that a range ... intention has been incorporated into virtually all models of health behaviour as the single best predictor of subsequent health behaviour In a review of 10 meta-analyses Sheeran demonstrated a consistent...

Ngày tải lên: 11/08/2014, 05:22

6 335 0
Báo cáo y học: " Severe hydrops in the infant of a Rhesus D-positive mother due to anti-c antibodies diagnosed antenatally: a case report" pot

Báo cáo y học: " Severe hydrops in the infant of a Rhesus D-positive mother due to anti-c antibodies diagnosed antenatally: a case report" pot

... reasons other than antigen to antibody incompatibility Immune hydrops results from maternal antibodies that are capable of crossing the placenta to react with fetal antigen, thus causing a reaction ... alloimmunisation in pregnancy Br J Obstet Gynaecol 1986, 93: 1 044 -1 048 Astrup J, Kornstad L: Presence of anti-c in the serum of 42 women giving birth to c positive babies: serological and clinical findings Acta ... mother, carried out the literature search and wrote the manuscript SK, KR, JBS and GK helped in managing the case and in providing the final draft of the manuscript All authors read and approved...

Ngày tải lên: 11/08/2014, 11:23

4 408 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx

báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx

... 2008, 3: 51 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Browman GP, Snider A, Ellis P: Negotiating for change The healthcare manager as catalyst for evidence-based practice: ... for innovation in teams Economic and Industrial Democracy 20 04, 25 :30 1 -31 8 Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators Academy of management ... evidence-based nursing Canadian Journal of Nursing Leadership 2000, 13: 31 -37 Estabrooks C: Translating research into practice: Implications for organizations and administrators Canadian Journal of Nursing...

Ngày tải lên: 11/08/2014, 16:21

10 453 0
Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

Báo cáo khoa học: "The epidemiology of severe sepsis in England, Wales and Northern Ireland, 1996 to 2004: secondary analysis of a high quality clinical" pps

... (37 .4 38 .6) 121 (108 – 138 ) 29 ( 23 36 ) 4. 7 (4. 0–5 .4) 11,986 ( 73. 1) 11.8 (7 .3 16.8) 20 04 38 .0 (37 .4 38 .7) 120 (107 – 135 ) 29 ( 23 36 ) 4. 6 (4. 0–5 .4) 5, 141 ( 73. 1) 11.9 (7 .3 17.0) Totalc 38 .0 (37 .4 38 .7) ... (7.1–16 .3) 2001 38 .0 (37 .4 38 .7) 1 24 ( 110 140 ) 28 (22 35 ) 4. 6 (4. 0–5 .4) 10, 146 (76 .3) 11.8 (7 .4 16.6) 2002 38 .0 (37 .4 38 .6) 122 (108 – 138 ) 28 ( 23 36 ) 4. 6 (4. 0–5 .4) 11,9 04 ( 73. 7) 11.8 (7 .4 16.6) 20 03 38.0 ... 98.6 39 , 43 7 10, 9 23 (27.7) 2001 129 110 .4 47,688 13, 325 (27.9) 2002 148 1 34 .2 59 ,38 8 16,285 (27 .4) 20 03 151 129 .3 59,527 16,5 94 (27.9) 20 04 100 54. 7 24, 905 7, 145 (28.7) Totala> 172b 8 14. 0 34 3,860...

Ngày tải lên: 12/08/2014, 23:22

10 340 0
Báo cáo sinh học: "Phenotypic plasticity of body pigmentation in Drosophila: Computing marginal posterior densities of genetic parameters of a multiple trait animal model using Laplace approximation or Gibbs sampling" pps

Báo cáo sinh học: "Phenotypic plasticity of body pigmentation in Drosophila: Computing marginal posterior densities of genetic parameters of a multiple trait animal model using Laplace approximation or Gibbs sampling" pps

... by a factor of 32 4 to 188 smaller than the actual chain length 2 648 , (SDM) ranged 1 535 to Marginal posterior probability density of genetic parameters and show an excellent agreement of the marginal ... Sampling-based approaches to calculating marginal densities J Am Stat Assoc 85, 39 8 -40 9 Gelman A, Carlin JB, Stern HS, Rubin DB (1995) Bayesian Data Analysis Chapman & Hall, London Geyer CJ (1992) Practical ... approximation of the marginal densities of all genetic parameters amounts to 3. 3 h In contrast, generating the 500 000 samples of one Gibbs chain and post sampling analysis took 18 h of CPU-time, which adds...

Ngày tải lên: 14/08/2014, 15:21

24 209 0
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 3

Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 3

... 2002) One caspase can activate another caspase leading to the formation of a caspase cascade that amplifies the death signal In a typical cell undergoing apoptosis two distinct mechanisms have been ... central mechanism that can be specifically targeted for the treatment of cancer Caspases are a family of proteins that play an important role as effectors of apoptosis The caspases are a group of ... resulting in the induction of apoptosis A receptor pathway that recruits caspase leading to Bid cleavage that engages the mitochondria by release of cytochrome C and caspase 9, or caspase directly...

Ngày tải lên: 16/09/2015, 17:11

193 366 0
sáng kiến kinh nghiệm phòng chống dịch bệnh một số kinh nghiệm phòng chống dich, bệnh cho trẻ 3 4 tuổi – lớp c1 ở trường mầm non a xã ngọc hồi

sáng kiến kinh nghiệm phòng chống dịch bệnh một số kinh nghiệm phòng chống dich, bệnh cho trẻ 3 4 tuổi – lớp c1 ở trường mầm non a xã ngọc hồi

... trước ăn phải r a tay Xoay cổ tay, xoa xoa mu bàn tay, đến kẽ ngón tay Em lau bàn tay sạch, em lau bàn tay xinh xinh xinh thật xinh + Sau hoạt động trời: Sau vui chơi trời trẻ quan sát, sờ, khám ... xuyên Hai, ba, bốn, ch a r a tay ch a ăn nha B a sáng, b a tr a, b a tối Năm, nhớ r a kỹ hai tay sau lần vệ sinh bạn nhé! Bài hát: Giờ ăn đến Giờ ăn đến rồi, ăn đến Trước ăn phải r a tay, trước ... trẻ r a tay thấy bạn r a mà không tự giác thực việc r a tay xà phòng trước ăn, sau vệ sinh, tay bẩn Qua theo dõi, nhận thấy trẻ ch a có thói quen tự giác r a tay ghi nhớ trẻ ch a tốt, trẻ hay quên...

Ngày tải lên: 31/03/2016, 16:34

31 5,5K 37
w