3—details of alternative groove preparations for prequalified corner joints see c 3 11 2

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Ngày tải lên : 08/03/2014, 08:20
... (pBSMARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC -3 ; ... Expression of the major PKC substrate, 80K/MARCKS, 36 4 G Wein et al (Eur J Biochem 27 0) 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 increases sharply when Swiss 3T3 cells move out of cycle ... CU-rich RNA was performed in the presence of increasing amounts of recombinant His6-HuD 20 lg of cytoplasmic extract of Swiss 3T3 cells was incubated with the radiolabeled MARCKS 52 nt CU-rich...
  • 16
  • 754
  • 0
Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc

Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc

Ngày tải lên : 30/03/2014, 16:20
... XlMGPF2 CCGGAGCTCAGCATCACTTATCAGATGC XlMGPF3 CCGGAGCTCGAGCCACCCACCTAACTTCTAGATCG XlMGPF4 CCGGAGCTCGAGTTCTAGATCGTACACCTTTGCC XlMGPF5 CCGGAGCTCGAGCACCTTTGCCCTCGGCTTCG XlMGPF6 CCGGAGCTCTTGCCCTCGGCTTCGGTTTTCT ... CCGGAGCTCTTGCCCTCGGCTTCGGTTTTCT XlMGPF7 CCGGAGCTCACTACCAAATAGAGCCTCC XlMGPF8 ATCTCAAAGTTCCTTCATAGAG XlMGPF9 ATGAAGACTCTTCCAGTTATTC XlMGPF10 CCGGAGCTCGAGCCACCAAAATAACTTCTAGATCGTAAAAATTTGCC ODC-speci c primers ODCF CAGCTAGCTGTGGTGTGG ... ⁄ +30 13LuC; +2 733 ⁄ +30 13LuC; +28 18 ⁄ +30 13LuC; +2 831 ⁄ +30 13LuC; +28 43 ⁄ +30 13LuC; +28 52 ⁄ +30 13LuC; and + 127 8 ⁄ +20 83LuC A6 cells were harvested 36 h after transfection, and the promoter activity...
  • 10
  • 457
  • 0
Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages

Alternative Processing Technologies for the Control of Spoilage Bacteria in Fruit Juices and Beverages

Ngày tải lên : 25/10/2013, 21:20
... references 9, 18, 23 25 © 20 03 by CRC Press LLC E coli ATCC 25 922 E coli ATCC 25 922 E coli ATCC 23 7 16 E coli ATCC 117 75 Enterobacter aerogenes Apples Apples (half) 0.5 1.9 1.4 1.7 2. 0 TX110_book ... to 30 days 35 0.41 36 2. 16 8 .34 6.40 3. 92 8. 62 6.91–8. 73 8.09–8.66 5.06–7.81 4 .2 35 36 37 38 3 4 38 (continued) © 20 03 by CRC Press LLC TX110_book Page 83 Tuesday, May 6, 20 03 9 :21 AM TABLE 4 .3 ... Apple Apple (cut) Apple (cut) Apple 1.6 3. 1 2. 6 5.5 1.1–1 .2 1.6–1.9 1 .2 2. 2 3 4 1 2 4.5 1 .3 2. 1 1 2 1 2 4.5 (continued) © 20 03 by CRC Press LLC TX110_book Page 75 Tuesday, May 6, 20 03 9 :21 AM TABLE...
  • 21
  • 691
  • 2
Tài liệu Báo cáo khoa học: "A Comparison of Alternative Parse Tree Paths for Labeling Semantic Roles" ppt

Tài liệu Báo cáo khoa học: "A Comparison of Alternative Parse Tree Paths for Labeling Semantic Roles" ppt

Ngày tải lên : 20/02/2014, 12:20
... Daniel Jurafsky 20 02 Automatic labeling of semantic roles, Computational Linguistics, 28 (3) :24 5 28 8 Klein, Dan and Christopher Manning 20 03 Accurate Unlexicalized Parsing, In Proceedings of the 41st ... curves of precision, recall, f-score, and adjusted recall achieved using the five different parse tree path encodings For each encoding approach, learning curves were created by applying successively ... class (Levin, 19 93) However, the encoding of individual parse tree paths for predicates is wholly dependent on the characteristics of the parse tree of a sentence, for which competing approaches...
  • 8
  • 520
  • 0
The Value and Impacts of Alternative Fuel Distribution Concepts- Assessing the Army’s Future Needs for Temporary Fuel Pipelines pptx

The Value and Impacts of Alternative Fuel Distribution Concepts- Assessing the Army’s Future Needs for Temporary Fuel Pipelines pptx

Ngày tải lên : 23/03/2014, 02:20
... 54 23 38 164 Sites Storage Terminal 13 PS1 PS2 39 PS3 52 Bag farm 82 26 15 24 19 26 Misc 12 13 Maint Headquarters, Department of the Army, Field Manual 3- 19.1, Change 1, pp 4-8 and C- 1 -2 27 82 ... 19 Maint 38 Miles Sites Storage Pipeline Maint Misc 12 16 Terminal 10 10 PS1 13 10 PS1 11 20 PS2 14 20 PS2 11 30 PS3 14 30 PS3 11 40 PS4 13 40 PS4 11 50 Bag farm 50 Bag farm 30 49 54 23 38 164 ... Misc 23 19 Maint 38 Miles Sites Storage Terminal Pipeline PS1 13 PS1 PS2 26 PS2 39 PS3 39 PS3 52 PS4 52 Bag farm 65 PS5 78 PS6 91 Bag farm 15 24 30 49 27 12 19 Pipeline Maint Misc 12 19 12 19...
  • 64
  • 324
  • 0
Use of Alternative Fuels in Cement Manufacture: Analysis of Fuel Characteristics and Feasibility for Use in the Chinese Cement Sector pdf

Use of Alternative Fuels in Cement Manufacture: Analysis of Fuel Characteristics and Feasibility for Use in the Chinese Cement Sector pdf

Ngày tải lên : 24/03/2014, 05:20
... (%) carbon emissions factorb (ton C/ ton) CO 2c (ton/ton coal replaced) rice husks 35 13. 2; 16 .2 10 0 .35 -2. 5 wheat straw 20 15.8a; 18 .2 7 .3; 14 .2 0. 42 -2. 5 corn stover 20 9 .2; 14.7; 15.4 9.4; 35 ... coal Calculation Conversion of C to CO2 : 0.68 ton C 44 ton CO2 2. 5 ton CO2 × = 12 ton C ton coal ton coal Non-carbon neutral fuels The change in CO2 per ton of coal replaced is the difference between ... 0 .24 -2. 5 paper sludge 20 8.5 70 0 .2 -2. 5 paper 20 12. 5 -22 0. 42 -2. 5 sawdust 20 16.5a 20 0 .38 -2. 5 waste wood 20 15.5; 17.4 33 .3 0 .34 -2. 5 animal waste (bone, meal, fat) 20 16-17; 19 15 0 .29 -2. 5...
  • 63
  • 750
  • 0
Evaluation of Demonstration Test Results of Alternative Technologies for Demilitarization of Assembled Chemical Weapons A Supplemental Review for Demonstration II pptx

Evaluation of Demonstration Test Results of Alternative Technologies for Demilitarization of Assembled Chemical Weapons A Supplemental Review for Demonstration II pptx

Ngày tải lên : 28/03/2014, 11:20
... PTFE /30 4L #2 PTFE /30 4L #1 Titanium #4 Titanium #3 Glass #2 Glass #1 Zirconium #5 Zirconium #4 22 .074 22 .118 20 .086 20 .29 0 22 .861 23 . 538 18.554 18.617 19 .30 6 19 .27 5 16 .34 3 16.197 16.475 15. 5 32 2 .31 7 ... amounts of CO, CO2, and O2 measured in the off-gas Using HD as an example, equations for the anodic reactions producing CO and CO2 are: C4 H8Cl2S + 8H2O ¡¡ 4CO + 24 H+ + 2Cl− + SO4 2 + 20 e− C4 H8Cl2S ... 2 .31 7 2. 268 2. 768 2. 8 43 3.7 43 4.0 93 6 .38 6 8.006 16. 23 7 16 .34 9 12. 54 12. 85 18.64 20 .17 27 .94 34 .01 87.51 87. 82 SOURCE: AEA (20 00) 16 ALTERNATIVE TECHNOLOGIES FOR DEMILITARIZATION OF ASSEMBLED CHEMICAL...
  • 66
  • 380
  • 0
Evaluation of Demonstration Test Results of Alternative Technologies for Demilitarization of Assembled Chemical Weapons A Supplemental Review docx

Evaluation of Demonstration Test Results of Alternative Technologies for Demilitarization of Assembled Chemical Weapons A Supplemental Review docx

Ngày tải lên : 28/03/2014, 11:20
... Avenue, N.W Washington, DC 20 418 (20 2) 33 4 -31 18 National Academy Press 21 01 Constitution Avenue, N.W., Lockbox 28 5 Washington, DC 20 055 (800) 624 - 624 2 or (20 2) 33 4 -33 13 (in the Washington metropolitan ... Unit for Mustard, 22 Catalytic Oxidation Unit for Nerve Agent, 22 18 xi xii CONTENTS Metal Parts Treater, 22 Safety Concerns, 23 Reevaluation of Steps Required for Implementation, 23 Review of ... positive force for public acceptance of alternatives to incineration Although the Dialogue process requires a significant commitment of time and resources, it has been a critical component of the ACWA...
  • 52
  • 402
  • 0
The Gale Encyclopedia of Alternative Medicine, Second Edition - VOLUME 3 ppt

The Gale Encyclopedia of Alternative Medicine, Second Edition - VOLUME 3 ppt

Ngày tải lên : 29/03/2014, 07:20
... seeds Codonopsis root Coenzyme Q10 Coix Cold sores Coleus Colic Colloidal silver Colonic irrigation Color therapy Colorectal cancer Colostrum Coltsfoot Comfrey Common cold Conjunctivitis Constipation ... Constipation Contact dermatitis Copper Coptis Cordyceps Corns and calluses Cornsilk Cornus Corydalis Cotton root bark Cough Cradle cap Cramp bark Cranberry Craniosacral therapy Creatine Crohn’s disease Croup ... Chiropractic Chlamydia Chlorella Cholesterol Chondroitin Christian Science healing Chromium Chronic fatigue syndrome Chrysanthemum flower Chymotrypsin Cicada Cinnamon bark Cirrhosis Cnidium seeds...
  • 614
  • 654
  • 0
Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 3 " pptx

Báo cáo nghiên cứu khoa học " Development of an Improved Capability in support of National Bio-security for the Surveillance and Control of Foot & Mouth Disease in Cattle and Pigs - Milestone 3 " pptx

Ngày tải lên : 22/06/2014, 12:20
... PLATE FORMAT S1 S1 S9 S9 S17 S17 S25 S25 S 33 10 S 33 11 12 A C+ + C+ + B S2 S2 S10 S10 S18 S18 S26 S26 S34 S34 C+ + C+ + C S3 S3 S11 S11 S19 S19 S27 S27 S35 S35 C+ C+ D S4 S4 S 12 S 12 S20 S20 S28 S28 S36 ... S36 S36 C+ C+ E S5 S5 S 13 S 13 S21 S21 S29 S29 S37 S37 C- C- F S6 S6 S14 S14 S 22 S 22 S30 S30 S38 S38 G S7 S7 S15 S15 S 23 S 23 S31 S31 S39 S39 S16 S16 S24 S24 S 32 S 32 S40 S40 OD MA X OD MA X CC OD ... 67 25 60 67 80 74 32 0 61 40 65 32 0 56 80 57 32 0 57 80 57 25 60 65 32 0 57 32 0 56 80 52 32 0 64 80 56 640 58 80 53 640 65 160 53 320 72 160 53 640 67 32 0 52 2660 63 320 54 80 57 40 52 32 0 65 80 63...
  • 23
  • 439
  • 0
Báo cáo hóa học: "Error Sign Feedback as an Alternative to Pilots for the Tracking of FEXT Transfer Functions in Downstream VDSL" pptx

Báo cáo hóa học: "Error Sign Feedback as an Alternative to Pilots for the Tracking of FEXT Transfer Functions in Downstream VDSL" pptx

Ngày tải lên : 22/06/2014, 23:20
... 48, no 3, pp 2 23 22 9, 20 02 D J Love and R W Heath Jr., “Limited feedback precoding for spatial multiplexing systems,” in Proceedings of IEEE Global Telecommunications Conference (GLOBECOM ’ 03) , ... Processing (1998 20 01), Chairman of the IEEE SPS SPCOM Technical Committee (20 02 20 04), and Editor-in-Chief of the IEEE Signal Processing Letters (20 02 20 05) He is currently the Editor-in-Chief of the ... precoding scheme achieving crosstalk cancellation with application to DSL systems,” in Proceedings of the 34 th Asilomar Conference on Signals, Systems and Computers (ACSSC ’00), vol 2, pp 1 627 – 1 631 ,...
  • 14
  • 601
  • 0
A position paper of the EPS Energy for the Future phần 3 potx

A position paper of the EPS Energy for the Future phần 3 potx

Ngày tải lên : 08/08/2014, 15:21
... of Spent Nuclear Fuel; Science, 2 93 (20 01) 23 9 7- 23 9 8 http://www.princeton.edu/~globsec/publications/pdf/Sciencev293n5 539 .pdf http://ec.europa.eu/energy/nuclear/doc/brusselsfdemay20 02. pdf ... suited for the thorium cycle Efficient actinide management; conversion of fertile U; closed cycle Efficient electricity production; option for actinide management; once-through uranium cycle in ... simple form; closed cycle also possible Once-through uranium cycle; electricity production and heat for petrochemical industry, thermo-chemical production of hydrogen Although research is still...
  • 10
  • 611
  • 0
Báo cáo y học: " Use of conventional and alternative treatment strategies for a case of low back pain in a F/A-18 aviator" pdf

Báo cáo y học: " Use of conventional and alternative treatment strategies for a case of low back pain in a F/A-18 aviator" pdf

Ngày tải lên : 13/08/2014, 14:20
... York: Churchill Livingstone; 1999 :24 9 -26 2 Bergmann TF, Peterson DH, Lawrence DJ: Chiropractic technique: principles and procedures NY: Churchill Livingstone; 19 93: 415-4 43 Barnes JF: Myofascial ... therapeutic exercise for an aviator with LBP Further research to investigate the use of lumbar exercises for pilots is necessary G forces are commonly cited as a cause of back pain in high performance ... S: Chiropractic: a profession at the crossroads of mainstream and alternative medicine Ann Intern Med 20 02, 136 :21 6 -22 7 Dunn KM, Croft PR: Epidemiology and natural history of low back pain Eur...
  • 6
  • 375
  • 0
Báo cáo y học: " Landmark survival as an end-point for trials in critically ill patients – comparison of alternative durations of follow-up: an exploratory analysis" doc

Báo cáo y học: " Landmark survival as an end-point for trials in critically ill patients – comparison of alternative durations of follow-up: an exploratory analysis" doc

Ngày tải lên : 13/08/2014, 18:22
... (1.16–1.41)* 1 .25 (1.15–1 .36 )* 1 .22 (1. 13 1 .31 )* 1.18 (1. 12 1 .24 )* 1. 13 (1.05–1 .22 )* Charlson 0.87 (0 . 32 2 .35 ) 0.87 (0 . 32 2 .35 ) 0.85 (0 .31 2 . 32 ) 0. 72 (0 .24 2. 13) 0.74 (0 .25 2. 18) (0–.) GCS 0. 62 (0.49–0.79)* ... (57 .3) 588 (55 .2) 0. 73 137 (77.8) 1599(75.6) 0.58 0.90 20 (9 .3) 19 (10) 0.80 13. 0 (9.8) 11. 0 (10.0) 0.001 41.6 ( 43. 6) 0.78 35 .5 (28 .3) 32 .2 (31 .0) 0.80 6 .3 ( 12. 1) 6 .2 ( 12. 4) 0. 12 (1.8) 126 (8.8) ... (1. 13 1.85)* 1 .31 (1 .11 1.54)* 1 .25 (1.15–1 .36 )* 1 .22 (1. 13 1 .31 )* 1.18 (1. 12 1 .24 )* 1.05 (1. 02 1.08)* 1. 13 (1.05–1 .22 )* APACHE = Acute Physiology and Chronic Health Evaluation; GCS = Glasgow Coma...
  • 8
  • 258
  • 0
Báo cáo sinh học: "A comparison of alternative methods to compute conditional genotype probabilities for genetic evaluation with finite locus models" ppsx

Báo cáo sinh học: "A comparison of alternative methods to compute conditional genotype probabilities for genetic evaluation with finite locus models" ppsx

Ngày tải lên : 14/08/2014, 13:22
... 10 11 12 13 16 17 18 19 20 21 22 23 24 25 47 48 49 50 51 52 53 54 55 56 26 14 15 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 ... seconds on a Dec Alphastation 500 for 1000 samples obtained with each of the three MCMC samplers for and locus models for situation Sampler No of loci ESIP 83 166 24 9 Blocking Gibbs 12 24 36 12 ... 1997 [27 ] Smith C. , Improvement of metric traits through speci c genetic loci, Anim Prod (1967) 34 9 35 8 [28 ] Stricker C. , Fernando R.L., Some theoretical aspects of finite locus models, in: Proceedings...
  • 20
  • 256
  • 0
Báo cáo y học: "Evidence of functional selection pressure for alternative splicing events that accelerate evolution of protein subsequences" pps

Báo cáo y học: "Evidence of functional selection pressure for alternative splicing events that accelerate evolution of protein subsequences" pps

Ngày tải lên : 14/08/2014, 14:21
... 18, 2 0 32 -9 Bernatchez, L & Landry, C (20 03) J Evol Biol 16, 36 3-77 Chen, L., Perlina, A & Lee, C J (20 04) J Virol 78, 37 22 - 32 Orban, T I & Olah, E (20 01) Trends Genet 17, 25 2 -3 Filip, L C & Mundy, ... for discussions on the possible interactions of Ks and Ka/Ks C. J.L was supported by NIH Grant U54-RR 021 8 13, and DOE grant DE-FC 02- 02ER 634 21 19 References 10 11 12 13 14 15 16 17 18 19 20 21 22 ... L., Church, D M., Edgar, R., Federhen, S., Helmberg, W., Madden, T L., Pontius, J U., Schuler, G D., Schriml, L M., Sequeira, E., Suzek, T O., 20 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44...
  • 30
  • 131
  • 0
Development of immersed boundary methods for isothermal and thermal flows 3

Development of immersed boundary methods for isothermal and thermal flows 3

Ngày tải lên : 09/09/2015, 11:17
... (1980) 1.50 2. 24 He et al (1997) 1.499 2. 245 Niu et al (20 06) 1.589 2. 26 Wu & Shu (20 09) 1.554 2 .3 Method 1.5 52 2 .37 Method 1. 526 2 .36 8 Cases Re=40 Present Table 3. 2 Comparison of consumed CPU time ... function-vorticity formulation-based IBM is the calculation of velocity correction Once it is determined, the corrected velocity and vorticity can be calculated from Eqs (3. 10) and (3. 11) respectively ... correction procedure is straightforward and easier as compared to that of velocity correction As shown in Eq (3. 12) , once the velocity correction has been obtained, the vorticity correction can...
  • 29
  • 200
  • 0
Development of membrane based electrodes for electroanalytical applications 3

Development of membrane based electrodes for electroanalytical applications 3

Ngày tải lên : 11/09/2015, 09:56
... Chemistry B, 20 08 1 12 (7): p 20 24 -2 030 23 Millesime, L., C Amiel, and B Chaufer, Journal of Membrane Science, 1994 89 (3) : p 2 23 - 23 4 24 Hirayama, K., S Akashi, M Furuya, and K Fukuhara, Biochemical and ... S.P., Scarffe M and Cornell B Journal of Materials Research, 20 07 22 (8): p 21 89 -21 94 Cho, N.J., S.J Cho, J.O Hardesty, J.S Glenn, and C. W Frank, Langmuir, 20 07 23 ( 21 ): p 10855-108 63 Becucci, L., ... and Biophysical Research Communications, 1990 1 73( 2) : p 639 -646 25 Nakatsuka, S and A.S Michaels, Journal of Membrane Science, 19 92 69 (3) : p 189- 21 1 26 Carlos Dm Filipe, R.G., Biotechnology and...
  • 28
  • 236
  • 0
Development of cell sheet constructs for layer by layer tissue engineering using the blood vessel as an experimental model 3

Development of cell sheet constructs for layer by layer tissue engineering using the blood vessel as an experimental model 3

Ngày tải lên : 14/09/2015, 08:49
... 21 030 2_ s_at 22 8 425 _at 23 8 8 52_ at 20 5111 _s_at 22 5975_at 23 2 23 1 _at 20 2 037 _s_at 20 6056_x_at 22 834 7_at 20 2 935 _s_at 22 2557_at 22 5665_at 2 033 72_ s_at 23 2 528 _at 20 5990_s_at ADAM metallopeptidase domain 12 (meltrin ... Progenitors 22 6777_at 20 5609_at 21 429 7_at 20 2 436 _s_at 22 628 1_at 22 7646_at 20 6115 _at 22 5079_at 21 031 0_s_at 20 4451_at 21 022 0_at 21 8469_at 23 5 521 _at 22 8904_at 2 0118 5_at 20 1508_at 2 038 51_at 22 6 534 _at 21 030 2_ s_at ... 0 . 32 2 0 . 32 2 0 . 32 2 0 .20 2 0 .22 8 1.78 0.5 0 .33 6 0.0907 0.0 23 5 0. 026 9 0 .118 0. 729 0. 729 0.04 03 0.04 03 0.0 437 Genes in List in Category 71 31 25 9 9 5 6 5 12 2 6 2 % of Genes in List in Category 38 .59...
  • 35
  • 251
  • 0
Identification of plant as a novel and alternative host model for burkholderia pseudomallei

Identification of plant as a novel and alternative host model for burkholderia pseudomallei

Ngày tải lên : 09/10/2015, 10:49
... KHWTTSS1P3 GGATCCGCCACGATATCCTCGAAAAG 60.7 KHWTTSS1P4 CTGCAGAGCTACGCCGTGAACGTATT 60.7 KHWTTSS2P1 GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT ... mutant 33 2. 2 .2. 1 Cloning and sub-cloning 33 2. 2 .2. 2 Conjugation 35 2. 2 .2 .3 Selection 36 2. 2 .2. 4 PCR confirmation 36 2. 2 .3 Generation of KHW∆TTSS2 37 2. 2.4 Generation of KHW∆TTSS1 /2 37 2. 2.5 Generation ... AAGCTTACGAGCTGGTCGTTGATCTC 55.0 BTTTSS3P1 TTGAATTCGCATTGCGCGTATTTCTTTT 56.0 BTTTSS3P2 TTGGATCCTGATCGACGACTTCAAGCAG 56.0 BTTTSS3P3 TTGGATCCGACGTTCGGCAAGCTGTT 56.0 BTTTSS3P4 TTTTAAGCTTACGCTGTACGACCCCAATC...
  • 119
  • 420
  • 0