3 ebv and hodgkin lymphoma a causative association
báo cáo khoa học: " Legionella pneumophila serogroup 3 pneumonia in a patient with low-grade 4 non-Hodgkin lymphoma: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:20
... unremarkable except for significant increases of erythrocyte sedimentation rate and C-reactive protein, minimal increases of aspartate aminotransferase and alanine aminotransferase, and mild anemia ... environmental investigation AM performed the microbiological diagnosis and drafted the manuscript AC and PF were responsible for the clinical management and therapy AV drafted the Mencacci et al Journal ... Clinical and Experimental Medicine, Internal Medicine and Oncology Section, Santa Maria della Misericordia Hospital, Sant’Andrea delle Fratte, Perugia, Italy Authors’ contributions CC carried out...
- 5
- 303
- 0
Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx
Ngày tải lên :
20/06/2014, 00:20
... the manuscript ES is the data manager of the German lymphoma study and participated in the statistical analysis and in the critical revision of this manuscript AN and NB who is the PI prepared, ... Würzburg/Lower Frankonia, Hamburg, Bielefeld/Guetersloh, and Munich In the mentioned study areas, all hospital and ambulatory physicians involved in the diagnosis and therapy of malignant lymphoma were asked ... prospectively all patients between 18 and 80 years with newly diagnosed lymphoma (NHL and HL) Lymphoma patients were required to be resident in the study area and to be familiar with the German language...
- 11
- 456
- 0
Báo cáo y học: "Prolonged hemophagocytic lymphohistiocytosis syndrome as an initial presentation of Hodgkin lymphoma: a case report" pdf
Ngày tải lên :
11/08/2014, 19:21
... splenomegaly and pancytopenia Abbreviations ALT: alanine aminotransferase; ANA: antinuclear antibody; AST: aspartate aminotransferase; BiPAP: bilevel positive airway pressure; CMV: cytomegalovirus; CT: ... declare that they have no competing interests Authors' contributions KC and SD analyzed and interpreted patient data and cared for the patient WK and EB analyzed and interpreted the bone marrow and ... examination revealed severe jaundice, petechial hemorrhages of the skin and gastric mucosa, mediastinal lymphadenopathy, and a hematoma over the left psoas muscle Diffuse alveolar damage was...
- 7
- 388
- 0
Báo cáo khoa học: "Soft tissue non-Hodgkin lymphoma of shoulder in a HIV patient: a report of a case and review of the literature" pps
Ngày tải lên :
09/08/2014, 07:21
... proximal femur in a HIV(+) patient Leuk Lymphoma 2002, 43(12):2405-7 Kiyohara T, Kumakiri M, Kobayashi H, Nakamura H, Ohkawara A: Cutaneous marginal zone B-cell lymphoma: a case accompanied by massive ... Bozas G, Anagnostou D, Tassidou A, Moulopoulos LA, Bamias A, Dimopoulos MA: Extranodal non -Hodgkin' s lymphoma presenting as an abdominal wall mass Leuk Lymphoma 2006, 47(2):329-332 Belaabidia ... 37:305-347 Sipsas NV, Kontos A, Panayiotakopoulos GD, Androulaki A, Zormpala A, Balafouta ME, Dounis E, Tsavaris N, Kordossis T: Extranodal non -Hodgkin lymphoma presenting as a soft tissue mass in the...
- 6
- 303
- 0
báo cáo khoa học: " Hypercalcemia and huge splenomegaly presenting in an elderly patient with B-cell non-Hodgkin’s lymphoma: a case report" potx
Ngày tải lên :
11/08/2014, 02:21
... Toronto, Ontario, Canada Authors’ contributions AG analyzed and interpreted data regarding our patient’s endocrine disease and hypercalcemia HA analyzed and interpreted data regarding her hematologic ... Table 2, the hypercalcemia was severe and life-threatening and immediate therapeutic modalities such as forced hydration and application of Table Clinical and laboratory data of B-cell NHL patients ... most cases due to suppression of the parathyroid glands and renal a- hydroxylase secondary to hypercalcemia It is also evident that hypercalcemia is a manifestation of advanced disease and, as with...
- 4
- 254
- 0
Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"
Ngày tải lên :
26/10/2012, 09:39
... 2008 Hungary ( Caucasian) Japan ( Asian) China(Taiwan) ( Asian) China ( Asian) China(Taiwan) ( Asian) United States ( African-American) Tunisia ( African) Spain (Caucasian) Korea ( Asian) MAF Power ... Table and Figure 1) We further performed stratified analysis according to asthma type (atopic asthma and non-atopic asthma), age (children and adult) and ethnicity (Asian and Caucasian and African ... and their up regulation into the airways of asthmatic patients causing tissue damage [23-25] Both atopic asthma and nonatopic asthma are associated with increased levels of RANTES in bronchoalveolar...
- 7
- 525
- 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
Ngày tải lên :
21/12/2013, 19:15
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make sure to switch ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
- 2
- 392
- 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc
Ngày tải lên :
18/01/2014, 04:20
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make sure to switch ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
- 2
- 374
- 0
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc
Ngày tải lên :
18/02/2014, 16:20
... J D Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved ... be either acidic or basic), properties that also characterize the natural granule-sorting helices of PC1 ⁄ 3, PC2 and PC5 ⁄ 6A Previous reports have suggested that PC1 ⁄ and PC2 associate with ... fixed with 4% paraformaldehyde, washed in NaCl ⁄ Tris, and permeabilized with ) 20 °C absolute methanol for 10 Slides were immunostained with polyclonal rabbit anti-ACTH (1 : 300) and anti-(mouse...
- 9
- 600
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
Ngày tải lên :
19/02/2014, 02:20
... CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA ... ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC In light ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT...
- 14
- 601
- 0
Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx
Ngày tải lên :
16/03/2014, 10:20
... PUFAs, such as DPA and EPA, in the differentiated mammary gland during pregnancy may act as a factor inducing functional mammary gland differentiation mediated by activation of Jak2 and Stat5 ... differentiation effect of pregnancy Table Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands Whole inguinal mammary fat pads were isolated and contents ... of Jak2 and Stat5 Whereas DPA and EPA activated Jak2 and Stat5, DHA did not induce Jak2 and Stat5 phosphorylation (Fig 2A) We also analyzed the effect of DPA on induction of Stat5 phosphorylation...
- 12
- 421
- 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx
Ngày tải lên :
29/03/2014, 21:20
... olfactory bulb, paraventricular nucleus (PVN) and supraoptic nucleus (SON) in the hypothalamus amygdaloid–hippocampal area, as well as the bed nucleus stria terminalis, paraventricular thalamus, superior ... administration in male Wistar rats Am J Physiol Endocrinol Metab 292, E913–E919 34 Hida T, Takahashi E, Shikata K, Hirohashi T, Sawai T, Seiki T, Tanaka H, Kawai T, Ito O, Arai T et al (2006) ... in postnatal and adult rat brains and hearts Localization and developmental patterns J Biol Chem 268, 15193–15199 25 Donizetti A, Grossi M, Pariante P, D’Aniello E, Izzo G, Minucci S & Aniello...
- 8
- 369
- 0
Báo cáo khoa học: Hodgkin Reed–Sternberg cells express 15-lipoxygenase-1 and are putative producers of eoxins in vivo Novel insight into the inflammatory features of classical Hodgkin lymphoma ppt
Ngày tải lên :
30/03/2014, 04:20
... forward 5¢-GAA GTT ATC AGT CGA CAT GGG TCT CTA CCG CA-3¢ and reverse 5¢-ATG GTC TAG AAA GCT TTT AGA TGG CCA CAC TGT TTT CCA CCA C-3¢ primers were used For partial 15-LO-2 amplification, forward ... temperature was 375 °C and sheath and auxiliary gas was optimal at 60 and arbitrary units, respectively Skimmer offset was at 10 V and tube lens was 99 V MS ⁄ MS product ions of 626, 497 and 440 m ... goat anti-(rabbit IgG) and alkaline phosphatase conjugated avidin-biotin complex VectorÒ Red Alkaline Phosphatase Substrate (Vector Laboratories, Burlingame, CA, USA) was used for 15-LO-1 visualization...
- 13
- 350
- 0
Upgrading IBM Systems Director Server on Windows and migrating to a Microsoft SQL Server or Microsoft SQL Server Express database Version 6 Release 3 pptx
Ngày tải lên :
31/03/2014, 16:20
... a non-default database instead of the default database v Migrate your default Apache Derby database to the default managed IBM DB2 database and then switch your database to a non-default database ... managed IBM DB2 database, a description of each attribute, and an example of each attribute Table Database configuration information and values Description Database configuration attribute Value ... the database Switching the database Related reference: Tips for database user authorities and passwords Database configuration attributes for the managed IBM DB2 database There are database configuration...
- 66
- 600
- 0
báo cáo hóa học:" A genetic association study between growth differentiation factor 5 (GDF 5) polymorphism and knee osteoarthritis in Thai population" ppt
Ngày tải lên :
20/06/2014, 07:20
... Mabuchi A, Kotani A, Kawakami A, Yamamoto S, Uchida A, Nakamura K, Notoya K, Nakamura Y, Ikegawa S: An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility ... to osteoarthritis Nat Genet 2005, 37:138-144 Mabuchi A, Ikeda T, Fukuda A, Koshizuka Y, Hiraoka H, Miyoshi K, Haga N, Kawaguchi H, Kawakami A, Yamamoto S, Takatori Y, Nakamura K, Ikegawa S: Identification ... 46:456-462 10 Mototani H, Mabuchi A, Saito S, Fujioka M, Iida A, Takatori Y, Kotani A, Kubo T, Nakamura K, Sekine A, Murakami Y, Tsunoda T, Notoya K, Nakamura Y, Ikegawa S: A functional single nucleotide...
- 5
- 339
- 0
Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A (1, 2, 3) Period 21 ppsx
Ngày tải lên :
23/07/2014, 15:20
... hide-andseek,exciting Sure, want -Look, listen and repeat Listen and repeat sentence by - Guide Ss use question and sentence answer: Ss work in pair Do you want to play hide -and- se Some pairs practice ... to talk Sure Two or four Ss read in front of t b- White- listen class Play a tape times Other listen carefully and remar c- Post-listen Call some Ss read again Look and say - read follow teacher ... remark play hide and- seek 3.Let’s talk Work in pair: one asks – one Activity 4(10’) answers 3.Let’s talk Other listen and remark - Guide Ss to talk - Call some pairs talk in front of the class...
- 6
- 2.5K
- 2
![Báo cáo toán học: "On STD6[18, 3]’s and STD7[21, 3]’s admitting a semiregular automorphism group of order 9" doc](https://media.store123doc.com/images/document/2014_08/08/medium_DWcUkE1BIS.jpg)
Báo cáo toán học: "On STD6[18, 3]’s and STD7[21, 3]’s admitting a semiregular automorphism group of order 9" doc
Ngày tải lên :
08/08/2014, 01:20
... an elation group and any element of G is said to be an elation In this case, it is known that G acts semiregularly on each point class and on each block class Enumerating symmetric transversal ... N J A Sloane, and John Stufken, Orthogonal Arrays, Springer-Verlag New York (1999) [7] Y Hiramine, Modified generalized Hadamard matrices and construction for transversal designs, to appear in ... have a semiregular noncyclic automorphism group of order on both points and blocks containing an elation of order These are D(K1 ), D (K2 ), and D(K1 )d , where K1 and K2 are generalized Hadamard...
- 21
- 217
- 0
Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx
Ngày tải lên :
08/08/2014, 23:21
... draft the paper; GM and AK helped draft the paper; II carried out the statistical analysis and helped draft the paper; NS and AV supervised the study; NT carried out Page of the statistical analysis, ... Chin K, Ohi M, Nakagawa M, Fujita M, Sato K, Shimada K, Yamaoka S, Oda Y, Asai N, Sagawa Y, Kuno K: Relationship between dyspnoea in daily life and psycho-physiologic state in patients with chronic ... regulate emotions and affect and, therefore, may lead to increased somatisation and attenuated capacity to recognise the Table 5: Stepwise multiple regression (only statistically significant variables...
- 7
- 436
- 0