3 dual energy ct for characterization of pulmonary nodules

Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance (Protocol) pptx

Xpert MTB/RIF test for detection of pulmonary tuberculosis and rifampicin resistance (Protocol) pptx

Ngày tải lên : 06/03/2014, 04:20
... detected; RIF resistance not detected MTB detected; RIF resistance detected MTB detected; RIF resistance indeterminate MTB not detected; RIF not detected Xpert MTB/RIF test for detection of pulmonary ... name and manufacturer of the reference standard • Details of index test: software version of test • Details of comparator: type of microscopy: light or fluorescence; type of smear: direct or concentrated; ... A: The reference standard for the diagnosis of active pulmonary TB is solid or liquid mycobacterial culture Review question B: The reference standard for detection of rifampicin resistance is...
  • 23
  • 505
  • 0
Báo cáo hóa học: " Optimizing atomic force microscopy for characterization of diamond-protein interfaces" docx

Báo cáo hóa học: " Optimizing atomic force microscopy for characterization of diamond-protein interfaces" docx

Ngày tải lên : 21/06/2014, 04:20
... nano-interfaces of semiconductors and organic materials towards opto-electronic and bio-electronic applications Main interests lie in characterization and modification of material, electronic, and ... size was characterized by Lx values, which were determined using autocorrelation function Root mean square (RMS) values were employed for characterization of amplitude variations of topography ... technologically [24,25] Characterization and understanding of interactions at organic-inorganic interfaces is extremely important also for human safety [26] AFM is one the main methods for such studies...
  • 10
  • 445
  • 0
Báo cáo khoa học: "The 23S rRNA gene PCR-RFLP used for characterization of porcine intestinal spirochete isolates" pptx

Báo cáo khoa học: "The 23S rRNA gene PCR-RFLP used for characterization of porcine intestinal spirochete isolates" pptx

Ngày tải lên : 07/08/2014, 18:21
... ANRr S61 a roF tcnitsid ylhgih saw nrettap noitcirtser eht hguoht ,devresnoc ylhgih ton era gnidnib remirp rof secneuqes tegrat eht taht seilpmi siht ;desu erew sremirp fo stes ruof ,]61[ tnemirepxe ... esoraga morf deifirup dna desicxe erew pb 715 erew taht stcudorp RCP nim rof Co27 ta pets noisnetxe lanif a htiw ,s 03 rof Co27 sretcarahc dlob ni nwohs era stnemgarf noitcirtser euqinU** sleg ... eht ,leg esoraga %3 gnisu nehw ,revewoH troffe dna emit erom seriuqer dna ,gnidaer dna gnildnah htiw seitluciffid yb detacilpmoc si PLFR-RCP ANRr S32 rof gniniats etartin revlis htiw sleg edimalyrcaylop...
  • 4
  • 168
  • 0
Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx

Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx

Ngày tải lên : 09/08/2014, 03:22
... written informed consent from the patients for preoperative PET /CT, and then collected their preoperative staging data and surgical results for this retrospective study PET /CT imaging Before PET /CT ... undetectable by CT scanning Contrary to above usage of PET -CT in gastric cancer, we focused on the prediction of surgical finding through the result of preoperative PET -CT The results of our ... other SUV cutoffs for primary tumors or even with conventional enhanced CT scanning (sensitivity of 17.6%, specificity of 87.9%, accuracy of 69.9% and a positive predictive value of 33.3%) (Table...
  • 7
  • 470
  • 0
báo cáo khoa học: " Nucleoside conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists" pdf

báo cáo khoa học: " Nucleoside conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists" pdf

Ngày tải lên : 11/08/2014, 00:22
... adduct APEC, 1b, Figure 1) [15] were suitable functionalized congeners for this purpose [16] New ligand probes with fluorescent reporter groups are needed for detection and characterization of ... 100-180 for conjugates and and 50-110 for conjugates and The presence of all the functionality, including TA and CGS21680, was determined by IR spectroscopy of the QD conjugates IR spectrum for free ... conjugates of quantum dots for characterization of G protein-coupled receptors: strategies for immobilizing A2A adenosine receptor agonists Journal of Nanobiotechnology 2010, 8:11 Page 19 of 19 ...
  • 19
  • 194
  • 0
Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

Ngày tải lên : 13/08/2014, 14:20
... GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAGCCGTCTCTTGATCAGTGATCAAAT GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAGCCGTCTCTTGATCAGTGATCAAAT GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAACCGTCTCTTGATCAGTGATCAAAT GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAACCGTCTCTTGATCAGTGATCAAAT ... GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAACCGTCTCTTGATCAGTGATCAAAT GATGAAGTGAGGCTTTGCTGTACTGTTACAATGTAACCGTCTCTTGATCAGTGATCACAT GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAACCGTCTCTTGATCAGTGATCACAT GATGAAGTGAGGCTTTGCTGTACTGTTATAATGTAACCGTCTCTTGATCAGTGATCACAT ... CTCTTGAGCAATCCAAATGTTTTGTTATCA CATAAATCACTTTATAACATAACGAGCTCGTATT 1.03 CGCGACAGAGGGGTTTTCTTTCTATTA 0.95 AGACGCCTCACTTTGATAGACATGAGTTTA 0.89 Sn-S62-a CGACAGTAAACATAAAAACCG 1* CTGTTACCATTGGCTCTTTACC CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA...
  • 9
  • 352
  • 0
Adaptation and application of a state of the art impedance analyzer for characterization of silicon p i n diodes

Adaptation and application of a state of the art impedance analyzer for characterization of silicon p i n diodes

Ngày tải lên : 26/09/2015, 10:59
... left unpassivated Bottom: effective density of states of amorphous silicon as a function of electron energy [1-2] 46 x Figure 4.2 (a) Schematic of the structure of a-Si:H and µc-Si:H thin film ... part of the impedance [Im (Z)] as function of frequency • A plot which consists of magnitude of impedance (|Z|) as function of frequency and phase angle of the impedance (Φ) as function of frequency ... Current Ec Energy of Conduction Band Ef Fermi Energy Ev Energy of Valence Band G Conductance Im(Z) Imaginary part of impedance k Kilo n Refractive index P Non-ideality factor of Constant Phase Element...
  • 88
  • 326
  • 0
ICA based EEG energy spectrum for detection of negative emotion by EEG

ICA based EEG energy spectrum for detection of negative emotion by EEG

Ngày tải lên : 22/10/2015, 21:19
... from (low) – (high) For example, picture of a baby or a couple hugging is of high valence i.e pleasant pictures; picture of mushroom or stool is of neutral valence i.e neutral pictures and low valence ... Spectrum ICA-based EEG Energy Spectrum This chapter describes the biological basis of ICA-based EEG Energy Spectrum, as well as the principle of ICA-based EEG Energy Spectrum, which includes Independent ... Figure 3.1 Some Brain Activities 18 ICA-based EEG Energy Spectrum For simplification, each of this activated neuron group can be viewed as one electrical source and all the electrical sources are...
  • 92
  • 252
  • 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Ngày tải lên : 19/02/2014, 16:20
... investigate the effect of Oct-1 or Oct-2 on Prm3-directed luciferase expression, the previously described pcDNA3:HaOct-1 or pcDNA3:HaOct-2 plasmids [46] encoding Oct-1 and Oct-2, respectively, were ... 5¢-dTAATCACAAGCAAATCTTCTCTC-3¢; corresponding to NTs )115 to )92 of Prm3); (b) mutated Oct-1 ⁄ 2* (Kin193; 5¢-dGAATTAATCACAAGCAAGTCTTCTCTC GCCTCCCAGTC-3¢; corresponding to NTs )119 to )83 of Prm3 where ... over-expression of both Oct-1 and Oct-2 significantly increased Prm3directed luciferase activity in HEK293 and HEL cells Hence, it is evident that Oct-2 can function as a transacting element capable of regulating...
  • 18
  • 509
  • 0
Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx

Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx

Ngày tải lên : 23/03/2014, 20:22
... A 1-L culture of E coli yielded mg of pure GAPDH with a specic activity of 146 11 Uặmg)1 when NADPH was used as cofactor and a specic activity of 35 Uặmg)1 when NADH-dependent activity was monitored ... value of histidine The pKb values were also the same for all activities studied, and corresponded to the pK of cysteine The pH optimum pKa ỵ pKb of native GAPDH for NADPH-dependent activity ... NADPH was cofactor They were slightly higher for recombinant GAPDH (9 ã 105 M)1ặs)1) than for the native enzyme (3 ã 105 M)1ặs)1) when NADH was used as cofactor ể FEBS 2003 Kinetics of native...
  • 8
  • 335
  • 0
Báo cáo hóa học: "Synthesis and characterization of VO2-based thermochromic thin films for energy-efficient windows" pdf

Báo cáo hóa học: "Synthesis and characterization of VO2-based thermochromic thin films for energy-efficient windows" pdf

Ngày tải lên : 21/06/2014, 04:20
... influence of each element and respective concentrations on the crystal structure of the films, optical/thermochromic performance and effectiveness on the reduction of the semiconductor-metal ... derivative of both curves of the hysteresis loops (heating and cooling) and considering the mean value Results and discussion Structural characterization The crystal structure of the three sets of films ... diffraction spectra are shown in Figure The XRD patterns show the range where the most significant reflection peaks of VO appear The poor signal intensities of the crystallitereflected plane directions...
  • 7
  • 601
  • 0
design, synthesis, and characterization of polymeric materials for uses in energy storage applications

design, synthesis, and characterization of polymeric materials for uses in energy storage applications

Ngày tải lên : 13/11/2014, 11:13
... Allcock Evan Pugh Professor of Chemistry Thesis Advisor Chair of Committee Karl T Mueller Associate Professor of Chemistry Alan J Benesi Lecturer in Chemistry James P Runt Professor of Polymer Science ... synthesis, and characterization of polymeric materials for energy storage applications, which include small molecule electrolyte additives, solid polymer electrolyte, and gel polymer electrolyte systems ... for deprotection and lithiation of polymers 6-9 .139 4.2.9 Preparation of polymer electrolyte samples for impedance analysis 140 4.2.10 Preparation of films for static water contact angle measurements...
  • 229
  • 608
  • 0
Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 3

Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 3

Ngày tải lên : 14/09/2015, 08:46
... absorption (blue) and (b) photoluminescence (red) spectra of CdSe NPs (t = min) 8.2.3 Structural Characterization of ZnSe and CdSe NPs The XRPD spectra of the synthesized ZnSe and CdSe NPs are shown ... spectra of CdSe NPs synthesized with/without HPA To examine the effect of HPA on the growth of CdSe NPs, the samples were synthesized in various HPA concentrations and absorption spectra of the ... TOP/TOPO/HPA surfactants respectively In this study, it is found that trace amounts of HDA and HPA are crucial for the formation of high quality ZnSe and CdSe NPs In the case of ZnSe, a broad...
  • 69
  • 307
  • 0
A framework for formalization and characterization of simulation performance 3

A framework for formalization and characterization of simulation performance 3

Ngày tải lên : 16/09/2015, 17:12
... performance of the Time Warp protocol [DAS97] In particular, they studied the time performance of the Time Warp protocol as a function of the available memory space Chapter Performance Characterization ... point of time One event may have to be processed after another event Therefore, Chapter Performance Characterization 90 the degree of dependency among events is affected by the strictness of the ... order of the BL protocol is stricter than that of the BTW protocol Chapter Performance Characterization 98 Theorem 3.8 The event order of BTW protocol is stricter than partial event order Proof...
  • 41
  • 215
  • 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 3

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 3

Ngày tải lên : 16/09/2015, 17:13
... DNA One µl each of the first-strand RT reactions (Section 3.2.8) was used in 10 µl of real-time PCR reaction, which contained 5.8 µl of dH2O, 1.2 µl of 25 mM MgCl2, 0.5 µl each of forward and reverse ... manufacturer’s instructions with adjustment Briefly, each 10 µl of reaction mixture contains 0.8 µl of 25 mM MgCl2, 0.5 µl of each primer (10 µM), 0.2 µl of RT-PCR Enzyme Mix, µl of RT-PCR Reaction ... reactions were performed for all samples at the same time Briefly, µg of total RNA was used in each 20 µl reaction, which contained µl of random hexamers (50 ng/µl), µl of 10 mM dNTP mix, µl of...
  • 52
  • 272
  • 0
Fabrication and characterization of semiconductor nanowires for thermoelectric application 3

Fabrication and characterization of semiconductor nanowires for thermoelectric application 3

Ngày tải lên : 13/10/2015, 15:57
... manner The interaction of the electrons with the atoms of the sample produces signals and information of the sample surface such as composition, topography and electrical conductivity A SEM has ... frequency for the Ge nanowire sample was 1000 Hz, 0.03 s of time constant was sufficient for stability 3.11 Ceramic heater setup for temperature dependence characterization of thermal conductivity ... Si substrate for dispersing Ge nanowire and depositing the contacting electrodes The Si substrate sample selected for dispersing the Ge nanowires and depositing the contacting electrodes is similar...
  • 24
  • 207
  • 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

Ngày tải lên : 25/10/2012, 11:10
... inhibition of Pgp [3] Unfortunately these strategies are frequently associated with increase the risk of side effects of the statins [3,7].Therefore the developments of novel pharmaceutical formulations ... system of primaquine: in vitro characterization J Microencapsul 1992; 9(3):357-364 34 Hamidi M, Tajerzadeh H, Dehpour AR, Rouini MR, Ejtemaee-Mehr S In vitro characterization of human intact erythrocytes ... effect of time on loading efficiency and loading process was done for the previous concentrations for different times (15, 30, 60, 120 minutes) and compare the results [24] Study the effect of...
  • 9
  • 829
  • 0
Implications of building energy standard for sustainable energy efficient design in buildings

Implications of building energy standard for sustainable energy efficient design in buildings

Ngày tải lên : 05/09/2013, 14:58
... HVAC, electrical installations, lift and escalator, and other equipment 6.2 Establishment of policy framework for building energy standards The practice of building energy standard for energy saving ... Methodology for Optimising the Energy Performance of Buildings in Bahrain Energy and Building.2008, 40, 1297-1303 [50] Energy Efficiency in Buildings EU Forum Driving Investments for energy efficiency ... building energy conservation actions were carried out as buildings will need large amount of energy supply for their operations in the following years [23] Therefore, the requirements of building energy...
  • 12
  • 521
  • 0
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Ngày tải lên : 05/09/2013, 16:11
... conductive active energy (Ea) of the membranes were calculated, 18.58 kJ.mol−1 for Nafion-117 and 20.05 kJ.mol−1 for PVDF-SPS membrane, respectively Ea of the PVDFSPS membrane is close to that of ... micrograph of PVDF, PVDF-PS, PVDFSPS respectively; (d - f) cross-section of micrograph of PVDF, PVDF-PS, PVDF-SPS respectively ISSN 2076-2895 (Print), ISSN 2076-2909 (Online) ©2010 International Energy ... Figure 3c show the C1s core-level spectra, O1s corelevel spectra and S2p core-level spectra of the PVDF-SPS membrane, respectively The C1s core-level spectrum of the PVDF-SPS membrane can be curve-fitted...
  • 14
  • 596
  • 1
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing

Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing

Ngày tải lên : 05/09/2013, 16:11
... pH, protein content, cellulase and xylanase activity 2.9 Enzyme characterization The crude enzymes of TMC were characterized with respect to their activity under different pH (3-10) and temperature ... the formation of organic acid and reduced levels of ammonia after compost processing [41, 42] Table Characterization of yard waste compost samples Specifications YWCa-I YWC-II Location Bottom of ... 100% of activity for at least days at 550C and retained 47% activity at 800C [52] whereas the residual activity of a Caldibacillus cellulovorans cellulase was 83% after incubation at 70°C for...
  • 14
  • 525
  • 0