... important to superfluous Validation Information provided is not always accurate, so it is important for the team to validate the information gathered One method of validating information is to gather ... know to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from...
Ngày tải lên: 10/12/2013, 17:15
... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu New and Evolving Web-based Marketing – How to Find a Market Outlet for your Wildlife Friendly Products ppt
... equivalents are an obvious choice Some recent statistics from the National Mail Order Association (NMOA) and the American Catalog Mailers Association (ACMA) show that the US catalog industry is a ... http://atar.convio.net/site/PageServer?pagename=mrp 12 Green America’s searchable Green Pages (Formally known as Coop America) http://www.greenamericatoday.org/ 21 New and Evolving Web-based Marketing – How to Find a Market Outlet ... Organization (FAO) has declared 2009 the International Year of Natural Fibers so we are using Wildlife Friendly certified plant and animal fibers, specifically yarn as a mini case to illustrate...
Ngày tải lên: 18/02/2014, 22:20
She cannot find a way to pay for the tuition pot
... thể” “be capable of + V_ing” Ví dụ: “I can learn English well” = “I am able to learn English well” = “I am capable of learning English well” - Tôi có khả học giỏi tiếng Anh - “cannot” = “can’t” – ... (modal verb) có ngh a có thể, có khả Cấu trúc “Modal Verb (can, could, should, may, might… + V _nguyên thể” Ngoài để diễn đạt khả làm ta dùng “be able to” “be capable of” với cấu trúc sau: “be able ... từ đó) She cannot find a way to pay for the tuition 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: She cannot find a way to pay for the tuition 3 Tại câu lại dịch vậy? - “can” – động từ...
Ngày tải lên: 25/03/2014, 03:22
UNIT 5. DATABASE MANAGEMENT SYSTEMS LESSON 3. USING A DATABASE FOR DOCUMENT MANAGEMENTNOTE pptx
... database Database management systems - Using a database for document management - page Using a database for management There are advantages to using systems that manage both document content and ... - page Using a database for management If you decide to use a database, you have to know that there are two main ways in which it can manage metadata: Users Management 1) managing metadata in ... inside the same database System Document Meta Data Document Documents Database Using a database for management It is often easier to create a system which manages metadata in the database and points...
Ngày tải lên: 31/03/2014, 20:20
báo cáo khoa học: "The Unite for Diabetes campaign: Overcoming constraints to find a global policy solution" potx
... NCD rates: a lack of global advocacy, partnerships and interactions, capacity and resources, global norms and standards, as well as a health service orientation towards acute care [19] The authors ... campaign Global Response Global advocacy Partnerships and interactions Capacity and resources Global norms and standards Reorientation of health services What the Unite for Diabetes campaign adds ... treatment and cure of diabetes The campaign has two main parts – a top-down approach targeting major policymakers around the world, and a bottom-up approach aiming to make billion people aware...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx
... 5′GTCTCTCTGGTTAGACCAG-3′, Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC-3′ and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3′ and GAPDH ... http://www.retrovirology.com/content/8/1/61 reading and commenting on the manuscript, and Barbara Felber for sharing several critical reagents We are grateful to Anna Kula and Alessandro Marcello for sharing data in their paper prior ... blotting Antibodies Additional material Cell Culture, Transfection, and Reporter Assays Mouse monoclonal anti-HA (Sigma Chemical); mouse monoclonal Matrin 3, (Abcam) and rabbit anti-GFP and anti-HA...
Ngày tải lên: 13/08/2014, 01:21
rich industrialised nations are responsible for global warming so it is their duty to find a remedy do you agree
Ngày tải lên: 27/07/2016, 10:34
find a small word inside a bigger word 3
... want as their answer inflexible maintenance haunted introduce apartment cathedral yuppie plastic learning 10 intention 11 manager 12 tower 13 personal 14 amateur 15 instrument 16 admission 17 ... will find a smaller word Underline the smaller word We’ve done the first one for you as an example: Answers: Note: where there is more than one small word students can choose the one they want as ... Banana.com Test Your Spelling Skills Find a Small Word Inside a Bigger Word Did you know that sometimes you can find small words hiding inside bigger words? Look at the words below Inside each...
Ngày tải lên: 25/08/2016, 17:02
Chuong I - ĐẶC ĐIỂM CỦA CÔNG TRÌNH CRESCENT 3.1 – A
... phòng ban quản lý, sảnh tiếp tân tam giác trồng xanh tạo cảnh quan cho t a nhà Trước công trình khoảng không gian rộng, trồng hoa nhiều loại xanh Phần vườn hoa xanh thiết kế tỷ mỉ hài h a với ... có hai m a, m a khô m a m a, m a m a nhiệt độ không khí bảng 1.1 cao 310C TP Hồ SVTH: Hồ Sỹ Nam Luận văn tốt nghiệp GVHD: PGS.TS LÊ CHÍ HIỆP Chí Minh m a lạnh Do vấn đề cần vận hành điều h a không ... ban đầu bạc tỷ 1.2 Đặc điểm khí hậu vùng xây dựng công trình Công trình xây dựng TP Hồ Chí Minh, nằm khu vực ph a Nam nước Việt Nam, năm có hai m a: m a m a m a khô, vào m a khô khu vực phía...
Ngày tải lên: 26/04/2013, 16:38
Giáo án Anh 12 Unit 3, Test A (chẩn)
... a nice pair of glasses A : You really have a - a new and expensive watch nice pair of glaases I - a new cell phone think they make you - a modern looking pair of shoes attractive - a fashionable ... to make a complete paragraph - Language: Words used in writing about a paragraph Skills: Writing about a letter of recommendation II Method: Intergrated, mainly communicative III Teaching aids: ... appropriate language to talk about other ways of communication Knowledge: - General knowledge: Students can talk about other ways of communication - Language: Words to speak about ways of communication...
Ngày tải lên: 26/06/2013, 01:25
De + Dap an TS DH nam 2009 ca 3 khoi A, B, D
... Câu IV AC = 9a − 4a = 5a ⇒ AC = a BC = 5a − a = 4a ⇒ BC = 2a M H hình chiếu I xuống mặt ABC Ta có IH ⊥ AC IA/ A/ M IH 4a / = = ⇒ = ⇒ IH = I / IC AC AA 3 B 11 4a 4a VIABC = S ABC IH = 2a × a × = ... trụ đứng ABC .A B’C’ có đáy ABC tam giác vng B, AB = a, AA’ = 2a, A C = 3a Gọi M trung điểm đoạn thẳng A C’, I giao điểm AM A C Tính theo a thể tích khối tứ diện IABC khoảng cách từ điểm A đến mặt ... 2a × a × = (đvtt) 32 Tam giác A BC vuông B H Nên SA’BC= a 5 2a = a 2 / 2 Xét tam giác A BC IBC, Đáy IC = A C ⇒ S IBC = S A/ BC = a 3 C/ A A C 3VIABC 4a 3 2a a =3 = = S IBC 2a 5 2 2 Câu V S = (4x...
Ngày tải lên: 02/09/2013, 05:10
Tiết 28: Trường hợp bằng nhau thứ 3 của tam giác
... ba cu a tam giác góc – cạnh – góc (g.c.g) (Tiết 2) Vẽ tam giác biết một cạnh và hai góc kề Trường hợp bằng góc – cạnh – góc Hệ quả : C D B A E F Hình học : Thứ bảy ngày ... TRA BÀI CŨ: Câu : - Phát biểu trường hợp bằng thứ ba cu a tam giác Làm tiếp ? (Tr 122 – Sgk) - Câu : - Nêu tính chất v ề tổng hai góc nhọn tam giác vuông Cho tam giác ... hợp bằng thứ ba cu a tam giác góc – cạnh – góc (g.c.g) (Tiết 2) Hai tam giác vuông hình vẽ có bằng không ? Tại ? Tiết 28: D C B A E F Hình học : Thứ bảy ngày 27 – 11 – 2010...
Ngày tải lên: 22/10/2013, 13:11
Tài liệu Module 3: Designing a Software Distribution and Management Strategy ppt
... install and manage software: A Windows Installer package (an msi file), which is a relational database that contains information describing the installed state of the application An API that allows ... define the stages of the software management process Lead-in Each organization has its own approach, but any approach involves standard stages Packaging—Preparing an Application for Installation Distribution—Replicating ... company’s Change and Configuration Management infrastructure Software Distribution and Management Goals You have been asked to create a plan for the organization’s software distribution and management...
Ngày tải lên: 10/12/2013, 15:15
Tài liệu Activity 6.3: Determining a Preliminary Activity 6.3: Determining a Preliminary Network Topology pdf
... by writing a "U" for user services, "B" for business services, and "D" for data services at each machine with the service type that you expect to reside there After completing the above steps, ... of services Participate in small groups as assigned by the instructor Review the Ferguson and Bardell, Inc case study Review the network topology on this page Indicate where particular service ... responses with the class The instructor will write the class consensus on a flip chart SQL Server Exchange Win32 VB Client Satellite Office Consulting Manager Bandwidth Varies, depending on office...
Ngày tải lên: 10/12/2013, 16:16
Tài liệu Lab 5.2.3 Building a Basic Routed WAN ppt
... with an RJ45 Ethernet or Fast Ethernet interface (or an AUI interface) and at least one serial interface • 10Base-T AUI transceiver (DB15 to RJ45) for a router with an AUI Ethernet interface, ... or lab assistant to have the correct IP addresses on their LAN and WAN interfaces Router A will provide the clocking signal as DCE Start this lab with the equipment turned off and with cabling ... serial cables available in the lab Depending on the type of router and/or serial card, the router may have different connectors b Router serial port characteristics 3-7 CCNA 1: Networking Basics...
Ngày tải lên: 11/12/2013, 14:15
Tài liệu Module 3: Creating a Custom Team Folder Template doc
...
Ngày tải lên: 11/12/2013, 14:15