... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard...
Ngày tải lên: 14/03/2014, 23:20
... ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢ The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, Gottingen, Germany), ... hyperthermophilic archaeons and bacteria such as Thermotoga maritima, P furiosus and A fulgidus [5,28] In addition, homologs were found in close relatives of M mazei, such as Methanosarcina acetivorans and ... as desulfoferrodoxin and neelaredoxin are produced by anaerobic or microaerophilic prokaryotes, and are widespread among the bacterial and archaeal domains Desulfoferrodoxin from sulfate reducers...
Ngày tải lên: 28/03/2014, 23:20
the rise of modern philosophy a new history of western philosophy volume 3 sep 2006
... historical subjects I write of necessity as an amateur rather than as a professional In an age when the academic study of past philosophers has expanded exponentially, no one person can read more than ... between a variety of sins (WA VII.638) The Bible, as Erasmus had copiously shown, contains many passages that imply that human choices are free, and also many passages that proclaim that the fate of ... practical application of physics, and magic is the practical application of metaphysics This brisk and provocative anatomy of philosophy is not as neat as it seems, and many of the names Bacon gives...
Ngày tải lên: 11/06/2014, 10:31
báo cáo khoa học: " The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments" ppsx
... redundancy, respondent validation, and clear exposition of methods Triangulation of quantitative and qualitative data The quantitative and qualitative data paradigms will be combined, with adjustment ... the adoption and effective use of worksite wellness programs; and the translational model can be validated and manipulated in this and other settings to better understand and make translation ... training DVD and brief instructional manual To enhance fidelity and ease of use, the program is explicitly scripted with a team leader manual, elective manual, corresponding workbooks, and an expert...
Ngày tải lên: 10/08/2014, 10:23
Tài liệu Module 3: Creating a Custom Team Folder Template doc
... Templates, associate views with these templates, create an administration folder, and register templates Creating a Folder Home Page Creating an Administration Folder Home Page Creating a Template Initialization ... include an Administration folder home page, which can be used to control access to a team folder application Introduction to Creating an Administration Folder Home Page Creating an Administration ... Template Creating a View Tab Container Adding a Navigation Button There are times that you may want to add additional folders to your team project For example, you may want to include a conversation...
Ngày tải lên: 11/12/2013, 14:15
Tài liệu Module 3: Creating a Windows Installer Package doc
... create a Windows Installer package by repackaging the application Repackaging an application means creating a Windows Installer package for that application based on the installation and configuration ... Software Use a Third-Party Repackaging Use a Third-Party Repackaging Application to Repackage an Application to Repackage an Application Application Install the Package from Removable Install ... package and a repackaged Windows Installer package Repackage an application as a Windows Installer package by using the WinINSTALL LE third-party repackaging application Modify a Windows Installer...
Ngày tải lên: 21/12/2013, 05:18
Tài liệu Creating a New Access Database pptx
... and manipulate the objects in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a ... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; ... ADO Extensions for DDL and Security (ADOX) extends the ADO objects and programming model with objects for schema creation and modification, and for security ADOX is used to programmatically access...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc
... designers at a motorcycle factory Next, identify a spokesperson who can present the group’s ideas in a class discussion Brainstorm about your answers and present them in any format that will communicate ... design of current motorcycles You need to collect information to make an informed decision about the type of motorcycle that will attract new riders After you collect and analyze the information, ... characteristics Indicate at least two questions that you can ask each source Different sources may require different types of questions Assume that the three sources you identified have provided all of the...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu Creating a New SQL Server Database doc
... executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement in a similar way To drop the database ... statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are ... Oracle databases and other databases is similar to that shown for SQL Server although the DDL syntax for each database varies slightly because of differences in database server capabilities and...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
... group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of tools and ... ways to structure and manage organizations—both large and small, public and private—to foster collaborative and cooperative behavior In particular, it gives us a more sophisticated analysis of ... go hand-in-hand, posing a choice at every juncture, a choice that arises because of a basic dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt
... Na,K-ATPase alpha subunit Proc Natl Acad Sci USA 91, 2965–2969 50 Cantiello HF (1997) Changes in actin filament organization regulate Na+,K(+)-ATPase activity Role of actin phosphorylation Ann NY Acad Sci ... actin and analogs of spectrin and ankyrin Eur J Cell Biol 53, 93–100 6074 49 Devarajan P, Scaramuzzino DA & Morrow JS (1994) Ankyrin binds to two distinct cytoplasmic domains of Na,K-ATPase alpha ... carried out with ouabain, a natural blocker of the Na+ pump and an inhibitor of palytoxin action, have provided interesting findings Through the partial inhibition of Na+ ⁄ K+-ATPase, and regardless...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf
... and in collaboration with others Many challenges and discontinuities lie ahead 34 A new era of sustainability is far from guaranteed and will require both leadership and urgency As Paul Polman, ... Embed new concepts of value and performance at the organizational and individual levels • Devise mechanisms to measure both positive and negative impacts on society and articulate value beyond traditional ... companies to more than react to regulations presented as a fait accompli Companies must anticipate changes in the legal and regulatory landscape and work proactively with regulators to fashion...
Ngày tải lên: 18/02/2014, 21:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... favored and favored regions of the Ramachandran ˚ plot and r.m.s.d values for bond and angle of 0.005 A and 1.37 ° as shown in Table References Table Data collection and refinement statistics of ... Val-Ser-Ala-ArgflMet-Ala-Pro and Phe-Thr-Phe-ArgflSer-Ala-Arg for PAI-1 and PCI, respectively [6] By contrast, the reactive site loops of a1 -antichymotrypsin and heparin cofactor II contain leucine instead of arginine ... growth factors and proteinase inhibitors Biol Chem 380, 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- Crystal structure of the catalytic domain...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt
... from Takara Shuzo (Kyoto, Japan), Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA) All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure ... concentrations of NADPH and xed concentrations of pyruvate These indicate a sequential mechanism for the NMAADH reactions In fact, the data obtained gave a good global t to the equation of an ordered ... each primer (5Â-GGAAT TCCATATGTCCGCACCTTCCACCAGCACCG-3Â and 5Â-GGGAAGCTTTCAGCCAAGCAGCTCTTTCAGG-3Â), 2.5 U LA Taq DNA polymerase, and 115 ng genomic DNA from P putida ATCC12633: preincubation at...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu STRENGTHEN CONFIDENCE AND WORK TOGETHER FOR A NEW ROUND OF WORLD ECONOMIC GROWTH doc
Ngày tải lên: 21/02/2014, 01:20
Life and Physical Sciences Research for a New Era of Space Exploration docx
... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant ... Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant viii AERONAUTICS AND SPACE ENGINEERING BOARD RAYMOND ... Physical Sciences, Fundamental Physical Sciences, Human Behavior and Mental Health, Integrative and Translational Research for Human Systems, Plant and Microbial Biology, and Translation to Space...
Ngày tải lên: 05/03/2014, 11:21
Báo cáo " A NEW VIEW ON AN OLD PROBLEM IN QUANTUM CHROMODYNAMICS " potx
... A ; A = g + d4 L (8) τ a Aa ; Fµν = ∂µ A − ∂ν A + [A A ] 2i with the constraint equation equation δS/δAa = has been made in [13] According to this paper the quantization of only the transverse ... dimensional transmutation parameter - the analog of the arrangement energy resolution in QED (Recall that the old renormalization group QCD parameter Λ was also defined by a nonperturbative interaction ... Suan Han and gluons in the mass shell regime and simultaneously one proposes that quarks and gluons not contribute to the observable physical states of the left-hand side of Eq.(1) Just the absence...
Ngày tải lên: 05/03/2014, 14:20
Research Program of the Partnership for a New Generation of Vehicles doc
... Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and the Department of ... Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering viii Acknowledgments The committee wishes to thank all of the members of ... Princeton, New Jersey Staff JAMES ZUCCHETTO, Director RICHARD CAMPBELL, Program Officer ALAN CRANE, Program Officer MARTIN OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON,...
Ngày tải lên: 06/03/2014, 15:20
A New Database of Financial Reforms pot
... Lithuania Spain Azerbaijan Finland Madagascar Sri Lanka Bangladesh France Malaysia Sweden Belarus Georgia Mexico Switzerland Belgium Germany Morocco Taiwan Bolivia Ghana Mozambique Tanzania Brazil Greece ... Database Country name Albania Ecuador Kenya Russia Algeria Egypt Korea Senegal Argentina El Salvador Kyrgyz Republic Singapore Australia Estonia Latvia South Africa Austria Ethiopia Lithuania ... information for the U.S., Japan, Australia, New Zealand, Korea, Taiwan, the Philippines, Thailand, Indonesia, China, Singapore, Malaysia and Canada) De Brouwer, Gordon and Wisarn Pupphavesa, 1999,...
Ngày tải lên: 06/03/2014, 19:20