31 structural parts of a module 32
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx
Ngày tải lên :
12/07/2014, 01:20
... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...
- 13
- 596
- 2
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx
Ngày tải lên :
12/07/2014, 01:20
... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... viết tắt "Esq." ) thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi...
- 7
- 475
- 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf
Ngày tải lên :
12/07/2014, 01:20
... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... viết tắt "Esq." ) thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi...
- 7
- 574
- 1
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
Ngày tải lên :
18/02/2014, 11:20
... 1317813188 Maithal K, Ravindra G, Balaram H & Balaram P (2002) Inhibition of Plasmodium falciparum triosephosphate isomerase by chemical modication of an interface cysteine: electrospray ionization mass ... GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors Journal compilation ê 2009 FEBS M Banerjee et al ... 441456 Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme Pure Appl Chem 77, 281289 Parthasarathy S, Ravindra G, Balaram H, Balaram P & Murthy...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
Ngày tải lên :
18/02/2014, 17:20
... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 Torres AM, Tsampazi...
- 12
- 616
- 0
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot
Ngày tải lên :
06/03/2014, 01:20
... as an extracytoplasmic thioester acyl–enzyme intermediate Biochemistry 49, 341–346 Fukuda A, Matsuyama S, Hara T, Nakayama J, Nagasawa H & Tokuda H (2002) Aminoacylation of the N-terminal cysteine ... Depletion of apolipoprotein N-acyltransferase causes mislocalization of outer membrane lipoproteins in Escherichia coli J Biol Chem 280, 974–983 32 Kodama K, Fukuzawa S, Nakayama H, Kigawa T, Sakamoto ... sequence of the Gram-positive bacterium Bacillus subtilis Nature 390, 249–256 Baba T, Takeuchi F, Kuroda M, Yuzawa H, Aoki K, Oguchi A, Nagai Y, Iwama N, Asano K, Naimi T et al (2002) Genome and virulence...
- 13
- 407
- 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
Ngày tải lên :
08/03/2014, 02:21
... monosaccharide sequence and branching pattern Characterization of the Kdo-lipid A- OH region ESI-MS data (Table 1), fatty acid compositional analysis (yielding 3-hydroxytetradecanoic acid) and ... et al [28] The total content of fatty acids was analysed as described previously [29] Results Characterization of LPS Chromatography Gel filtration chromatography and GLC were carried out as described ... various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses correspond to the detector response of the GLC-MS Permethylation of dephosphorylated...
- 13
- 433
- 0
Báo cáo khoa học: Cytokinin-induced structural adaptability of a Lupinus luteus PR-10 protein potx
Ngày tải lên :
23/03/2014, 06:20
... MP, Abad L, Takeda S, Salzman R, Chen Z, Lee H, Hasegawa PM & Bressan RA (1996) Novel osmotically induced antifungal chitinases and bacterial expression of an active recombinant isoform Plant ... indicates that intracellular pathogenesisrelated proteins are ribonucleases Planta 193, 470–472 12 Samanani N & Facchini PJ (2002) Purification and characterization of norcoclaurine synthase The ... Venalainen TA, Hayrinen J, Laatikainen R, Perakyla M, Tervahauta AI & Karenlampi SO (2005) Birch PR-10c interacts with several biologically important ligands Phytochemistry 66, 2524–2533 37 Ilari...
- 14
- 410
- 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
Ngày tải lên :
23/03/2014, 09:20
... 5¢-CA FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS M Levisson et al GTCACCTGGTAGTTACTGCCGCCGAAG-3¢, 5¢-CGAC GATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAAGTTATTGAGATCGTCG-3¢, ... typical structural features of this type of enzyme Bacterial esterases and lipases have been classified into eight families based on a comparison of their amino acid sequences and some fundamental ... PAGE in duplicate One gel was stained with Coomassie Brilliant Blue (A) and the other was stained for activity using a- naphtyl acetate after renaturation (B) Lane M relative molecular mass standards;...
- 11
- 460
- 0
Báo cáo khoa học: Synthesis and structural characterization of a mimetic membrane-anchored prion protein doc
Ngày tải lên :
23/03/2014, 10:21
... complimentary mutagenic primers (IDS1 2A, 5¢CGATGGAAGAAGGTGCTGAGAATTCGAAGC-3¢ and IDS12B, 5¢-GCTTCGAATTCTCAGCACCTTCTTCCA TCG-3¢) were synthesized and purified by MWG-Biotech AG (Ebersberg, Germany) ... resolution of cm)1 and are an average of 1024 spectra collected at room temperature (21 °C) The water vapour signal was removed from the spectra and peak fitting was performed using grams software (ThermoGalactic, ... aberrant aggregated forms associated with disease An anomalous interaction of PrP with lipid could provide the initial unknown factor in spontaneous formation and subsequent accumulation of abnormal...
- 15
- 425
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
Ngày tải lên :
23/03/2014, 21:21
... strains that lack a capsular structure, which in itself provides serum resistance Recent data from our laboratory indicate that the ability of acapsular strains of H influenzae to elaborate sialylated ... potentially of great importance to the virulence of this organism Fig Structural model of the sialylated tetrasaccharide-containing glycoforms of O-deacylated LPS of H influenzae strain RM118 Mutant strains ... Sialylated LPS in Haemophilus influenzae (Eur J Biochem 269) 4011 Analytical methods and methylation analysis Sugars were determined as their alditol acetates and partially methylated alditol acetate...
- 11
- 579
- 0
Báo cáo khoa học: Solubility-dependent structural formation of a 25-residue, natively unfolded protein, induced by addition of a seven-residue peptide fragment pot
Ngày tải lên :
29/03/2014, 23:20
... 2009 FEBS KKFACPECPK10 YAFACPACPK YAFACPACPK YAFACPACPK YAFACPACPK RFMRSDHLSK20 RFMRSDALSK RFMRSDALSK RFMRSDALSK RFMRSDALSK HIKTHQNKK HIKTA HIKTAFIVVA30 HIKTAYIVVA HIKTAYISVA LG LG LG 2337 Solubility-dependent ... restraints are produced intramolecularly The final structural calculation of a FP1 molecule was performed using a total of 342 intraresidue, short-range and medium-range distance restraints and 25 backbone ... formation A M Araki and A Tamura B Fig NMR structures of FP1 (A) Backbone traces of the 10 best structures Backbones of residues 12–22, which adopt an a helix, are drawn in red (B) Schematic diagram...
- 12
- 338
- 0
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot
Ngày tải lên :
30/03/2014, 10:20
... biochemical analyses reported above A Electron cryomicroscopy and image analysis of the two-dimensional arrays B Fig Analysis of polypeptide composition of grana preparation Comparison of (A) SDS ⁄ PAGE ... projection appearance of negatively stained dimeric PSII core arrays [14,37,39–41] The arrangement of the particles within the array is such that they are substantially separated from each other and ... yielded a membranous fraction that pelleted at 40 000 g and was depleted in ATPase polypeptides as judged by SDS ⁄ PAGE analysis (Fig 4A) The absence of the ATPase complex indicates that the treatment...
- 15
- 476
- 0
Bài 17 - Parts of a paragraph (Kết cấu của đoạn văn)-phần1 ppsx
Ngày tải lên :
11/07/2014, 22:20
... hundred years old These three landmarks are truly amazing and make my hometown a famous place Bạn quan sát xem câu kết, These three landmarks are truly amazing and make my hometown a famous place, ... several amazing natural features, có câu hỏi thường xuất đầu họ Ở trường hợp câu: "What are the natural features that make Wheaton famous?" ( Đặc điểm tự nhiên làm cho Wheaton tiếng?) Sau người ... famous because it is located by Wheaton River, which is very wide, and because it is built near an unusually steep hill called Wheaton Hill There are two reasons why some people like to buy cars...
- 23
- 527
- 1
Bài 17 - Parts of a paragraph (Kết cấu của đoạn văn)-phần2 pptx
Ngày tải lên :
11/07/2014, 22:20
... Chọn số câu sau để làm câu chủ đề: (1) Solar-powered cars are expensive (2) There are many advantages and disadvantages to solar energy (3) The future practicality of solar cars depends on ... is so near the sun there are no bodies of water on its surface Earth, the third closest planet to the sun, has a cooler atmosphere that sustains animals, plants and several bodies of water on ... stands clearly against the sky and can be seen from many miles away The third amazing feature is the Big Old Tree This tree stands two hundred feet tall and is probably about six hundred years...
- 22
- 1.2K
- 3
Báo cáo lâm nghiệp: "Floristic and structural recovery of a laurel forest community after clear-cutting: A 60 years chronosequence on La Palma (Canary Islands)" ppt
Ngày tải lên :
07/08/2014, 16:20
... coordinates: Adenocarpus foliolosus: Adenfoli; Ageratina adenophora: Ageraden; Agrostis castellana: Agrocast; Aira caryophyllea: Airacary; Anagallis arvensis: Anagarve; Aphanes microcarpa: Aphamicr; Arrhenatherum ... eigenvalue was 0.83 (83% of the cumulative percentage of variance), and axis II eigenvalue was 0.14 (97% of the cumulative percentage of variance) ba: basal area; biomass: total aerial biomass; dead_b: ... (Erica arborea, Myrica faya and Laurus novocanariensis) and for the total community Bars are standard deviation from the mean (a) Mean aerial biomass; (b) mean basal area; (c) density; (d) mean...
- 11
- 385
- 0
Báo cáo y học: "Minocycline fails to modulate cerebrospinal fluid HIV infection or immune activation in chronic untreated HIV-1 infection: results of a pilot stud" doc
Ngày tải lên :
10/08/2014, 05:22
... University of California San Francisco, San Francisco, CA, USA 4Department of Neurology, University of Washington, Seattle, WA, USA 5Department of Neurology, Yale University, New Haven, CT, USA Page of ... concentrations as indices of CNS infection and immunoactivation [38] Change from baseline was calculated at weeks four and eight after initiation of minocycline treatment and after a 6-week wash-out ... have a number of properties that make it an attractive adjuvant therapy candidate In various model systems, it has been shown to have anti-inflammatory effects [43,44], including modulation of...
- 8
- 338
- 0
wordsearch 2 parts of a car
Ngày tải lên :
25/08/2016, 17:02
... English Banana.com Test Your Spelling Skills Wordsearch – Parts of a Car Answers: D S T H G I L D A E R G E A N N O R B H C H S U B E A R V I E W M I T L E B T A E S G A O T U L C I N ... N O S R A E G E O A P A S S E N G E R S E A T D L E E H W G N I R E E T S R For more fun tests, quizzes and games log onto www.englishbanana.com now! This worksheet can be photocopied and used ... games log onto www.englishbanana.com now! This worksheet can be photocopied and used without charge ...
- 2
- 127
- 0