3 what data is stored in a names server

Indexing XML Data Stored in a Relational Database pot

Indexing XML Data Stored in a Relational Database pot

... Tatarinov, E Viglas, K Beyer, J Shanmugasundaram, E Shekita Storing and Querying Ordered XML Using a Relational Database System SIGMOD 2002 References [21] M Yoshikawa and T Amagasa XRel: a path-based ... querying XML data type XQuery is a W3C standardsbased language in development It is a very powerful functional language for querying XML data In particular, it includes XPath 2.0 [18] Methods are ... produced using the document generator XMLGEN provided by the authors of XMark Instead of storing the entire data as a single, large XML instance, it is more natural in a relational database to store...

Ngày tải lên: 07/03/2014, 14:20

12 433 1
Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

... not a great deal of training data available, and the statistical methods used are simple and unsophisticated However, we still get a significant improvement on rules alone by adding a trainable ... concludes Semantic analysis as classification This section describes an abstract architecture which characterises semantic analysis as a task slightly extending the "decision-list" classification algorithm ... 22.2% Table 1: Percentage semantic interpretation errors on in- domain test data for different amounts of training data and different versions of the system Training and test data both in speech...

Ngày tải lên: 08/03/2014, 21:20

8 461 0
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx

– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx

... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and ... line has a slope of and a vertical line does not have a slope at all—it is undefined Parallel lines have equal slopes Perpendicular lines have slopes that are negative reciprocals Data Analysis Review ... angles are equal and the ratio of the corresponding sides is in proportion Parallelograms A parallelogram is a quadrilateral with two pairs of parallel sides B A C D In this figure, AB ʈ ෆD and BC...

Ngày tải lên: 18/06/2014, 17:20

25 410 0
Geoffrey byruch what to look for in a team

Geoffrey byruch what to look for in a team

... in years? Why? • What are you looking for in this company? • Are you interested in future supervisor positions? PASSION & ENTHUSIASM • Finding a candidate who is passionate and enthusiastic about ... workers are ones that are incredibly proactive in learning and furthering the quality of their work Finding a candidate of this caliber will eventually give your company and your business a strong ... amount of turnover When interviewing a client, gage if the client is willing to stay at the company for a long period of time You can so by asking the following questions: • What are your goals...

Ngày tải lên: 30/11/2015, 10:40

10 152 0
What it is to be a leader by geoffrey byruch

What it is to be a leader by geoffrey byruch

... John Quincy Adams once said that, “if your actions inspire others to dream more, learn more, more, and become more, you are a leader.” 
 Having a great idea and assembling a team to aid you ... but not least, be cognizant of the individual There is a fine line between asking and telling someone to something Make sure that you are asking Asking shows trust and understanding Telling shows ... journey is the first step in creating a successful business But what happens when you hit a bump in the road and morale is down? What if money is tight and the stress levels are at an all time...

Ngày tải lên: 30/11/2015, 10:43

17 276 0
Specifying Locking Hints in a SQL Server Database

Specifying Locking Hints in a SQL Server Database

... the DataAdapter and CommandBuilder SqlDataAdapter da = new SqlDataAdapter(cmd); SqlCommandBuilder cb = new SqlCommandBuilder(da); // Fill table using the DataAdapter DataTable dt = new DataTable( ... changing data being read by a user and preventing users from reading data being changed by a user Locks are acquired and released by user actions; they are managed internally by database software ... when reading a table This allows you to read data and later update it with a guarantee that it has not changed since you last read it while other users are not blocked from reading the data Cannot...

Ngày tải lên: 17/10/2013, 20:15

5 417 0
Tài liệu Specifying Locking Hints in a SQL Server Database doc

Tài liệu Specifying Locking Hints in a SQL Server Database doc

... the DataAdapter and CommandBuilder SqlDataAdapter da = new SqlDataAdapter(cmd); SqlCommandBuilder cb = new SqlCommandBuilder(da); // Fill table using the DataAdapter DataTable dt = new DataTable( ... changing data being read by a user and preventing users from reading data being changed by a user Locks are acquired and released by user actions; they are managed internally by database software ... when reading a table This allows you to read data and later update it with a guarantee that it has not changed since you last read it while other users are not blocked from reading the data Cannot...

Ngày tải lên: 14/12/2013, 18:16

5 541 0
Tài liệu Determining the Length of Columns in a SQL Server Table doc

Tài liệu Determining the Length of Columns in a SQL Server Table doc

... // Add table mappings da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet DataSet ds = new DataSet( ); // Fill the schema and data da.FillSchema(ds, ... Microsoft SQL Server Books Online The GetSchemaTable( ) method of the DataReader also returns all column lengths The method returns a DataTable containing column metadata for a DataReader, where ... FillSchema( ) method of the DataAdapter is also included The data type and nullable properties are available using both sp_help and FillSchema( ) For more information about the sp_help system stored...

Ngày tải lên: 24/12/2013, 05:15

4 458 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...

Ngày tải lên: 17/04/2013, 16:09

137 855 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse...

Ngày tải lên: 16/02/2014, 09:20

14 636 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

... CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI restriction site that ... (440 kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences ... Kawakami et al FAD, FMN and ATP-containing amino-acid dehydrogenase (dye-l-proDH) [3,4], and found these enzymes to be highly stable and to exhibit a high potential for application in amino-acid...

Ngày tải lên: 20/02/2014, 01:20

11 550 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... N-terminal kinase (JNK1) is rapidly activated in L-MAT cells, and that a dominant negative mutant of JNK prevented TCDD-induced cell death [7] Ghaffari-Tabrizi et al and others have demonstrated ... TCDD for h Then, a caspase-3 activation assay was performed as described in the Experimental procedures (A) Staurosporine, (B) Go6976, and (C) rottlerin Data are shown as average values ± SD ¨ (n ... PKCh kinase activity in vitro The kinase assay was performed by using 10 ng of a purified human recombinant PKCh enzyme in a reaction mixture that contained 50 lM ATP, 40 lM of a biotinylated PKCh...

Ngày tải lên: 23/03/2014, 13:20

13 426 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...

Ngày tải lên: 29/03/2014, 21:20

16 462 0
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot

Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot

... nonphosphorylated 14-3-3 interacting partners reveals five binding partners References are indicated in brackets after each interacting protein name and putative interaction amino acid residues are marked ... primer pair pexoSa (forward): 5¢-CGGAGAAACTCGAGGAGAAGGCAACCATC-3¢, pexoSb (reverse): 5¢-GTCTTTCTGGTACCACCGGTCA GGCCAGA-3¢ pMF419 and pMF420 were obtained by replacing the C-terminal ClaI/KpnI fragment ... proteins interact with all isoforms of the 14-3-3 family Finally, in vivo an ExoS protein lacking the 14-3-3 binding site is unable to ADP ribosylate cytoplasmatic proteins, e.g Ras, and is impaired...

Ngày tải lên: 31/03/2014, 08:20

9 394 0
báo cáo khoa học: "A case report of male breast cancer in a very young patient: What is changing" docx

báo cáo khoa học: "A case report of male breast cancer in a very young patient: What is changing" docx

... anatomopathological analysis confirmed the diagnosis of invasive ductal carcinoma with a 3.0-cm lesion in the biggest axle, which was histologic grade and nuclear grade Final breast surgical margins were ... strategies for male breast cancer are not based on data from randomized clinical studies in men and most treatment recommendations are extrapolated from data in women [8] Men with breast carcinoma ... of breast cancer in males is not adequately understood As more cases of breast cancer in young male patients are investigated, we may be able to gain a better understanding of the mechanism Consent...

Ngày tải lên: 09/08/2014, 01:24

5 400 0
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

... miR-145 3' UUCCCUAAGGACCCUUUUGACCUG |||||||||| Mouse 5' CUUGAAGAGAUAAGAAAACUGGAU Human 5' CUUGAAGGGAAGACAAAACUGGAU Rat 5' UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' ... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... |||||| 5' UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed...

Ngày tải lên: 11/08/2014, 12:20

12 242 0
MBA In A Day What You Would Learn at Top-Tier Business Schools phần 3 ppt

MBA In A Day What You Would Learn at Top-Tier Business Schools phần 3 ppt

... needs Leadership is not only about being a great speaker or politician; it is about having a vision and being able to make that vision a reality Team building is another important aspect of business ... business cannot afford to make mistakes—for instance, when a company is facing a crisis situation such as bankruptcy Laissez-Faire Leadership Delegating work works, provided the one delegating ... TLFeBOOK Leadership and Team Building 47 nization For ordinary leaders it can take years to shape the attitudes and environment; only an extraordinary leader is capable of making revolutionary change...

Ngày tải lên: 14/08/2014, 05:20

32 289 0
A Professional’s Guide to Data Communication in a TCP/IP World phần 3 pptx

A Professional’s Guide to Data Communication in a TCP/IP World phần 3 pptx

... shows a token and the fields in a frame containing an IP datagram The frame consists of an IEEE 802.5 header, an IEEE 802.2 LLC header, an IEEE 802.3 SNAP header, the payload (IP datagram), and an ... mediated analog telephone lines), so that a flag character or an escape character within the IP datagram payload shall not interrupt transmission, PPP employs character stuffing to change the meaning ... frame that encapsulates an IP datagram Intentionally, it is very similar to frames for IEEE 802.3 and IEEE 802.5 Like them, when transporting IP datagrams and ARP messages, FDDI uses a SNAP header...

Ngày tải lên: 14/08/2014, 13:20

27 411 0
artech house a professionals guide to data communication in a tcp ip world 2004 phần 3 pdf

artech house a professionals guide to data communication in a tcp ip world 2004 phần 3 pdf

... shows a token and the fields in a frame containing an IP datagram The frame consists of an IEEE 802.5 header, an IEEE 802.2 LLC header, an IEEE 802.3 SNAP header, the payload (IP datagram), and an ... Operation On asynchronous links (such as modem mediated analog telephone lines), so that a flag character or an escape character within the IP datagram payload shall not interrupt transmission, ... original data stream 4.1.2.3 Serial Line Internet Protocol Another encapsulation that can be used to transmit IP datagrams over a point-topoint link is Serial Line Internet Protocol (SLIP) It is a...

Ngày tải lên: 14/08/2014, 13:20

27 293 0
w