3 using transportable tablespaces with a physical standby database

... Database with Enterprise Manager Click “Add Standby Database. ” - 17 Copyright © 2006, Oracle All rights reserved Using the Add Standby Database Wizard Select “Create a new logical standby database. ” ... V $DATABASE • Database guard level is set to ALL by broker automatically on the logical standby database • Database guard level applies to all users except SYS 7-5 Copyright © 2006, Oracle All ... reserved Preparing to Create a Logical Standby Database Perform the following steps on the primary database before creating a logical standby database: Check for unsupported data types Be aware of...

Ngày tải lên: 09/12/2013, 16:15

... Adaptive example-based super-resolution using Kernel PCA with a novel classification approach Takahiro Ogawa∗1 and Miki Haseyama1 Graduate School of Information Science and Technology, Hokkaido ... expanding a given image based on an interpolator which is trained in advance with training data by using sparse Bayesian estimation [12] This method is not based on PCA and KPCA, but calculates ... local approaches, all of the training local patches are not necessarily in the same class, and their eigenspace tends not to be obtained accurately In addition, Kanemura et al proposed a framework...

Ngày tải lên: 18/06/2014, 22:20

... Adaptive example-based super-resolution using Kernel PCA with a novel classification approach Takahiro Ogawa∗1 and Miki Haseyama1 Graduate School of Information Science and Technology, Hokkaido ... expanding a given image based on an interpolator which is trained in advance with training data by using sparse Bayesian estimation [12] This method is not based on PCA and KPCA, but calculates ... local approaches, all of the training local patches are not necessarily in the same class, and their eigenspace tends not to be obtained accurately In addition, Kanemura et al proposed a framework...

Ngày tải lên: 20/06/2014, 04:20

... Features extracted by SIFT are invariant to image scale, rotation, and changing viewpoints The algorithm transforms a grayscale image into scale-invariant coordinates of local features, which are the ... and random data splits Fred and Jain [18], based on the idea of evidence accumulation, considered that each partition is viewed as an independent evidence of data organization Individual data ... indices to a palette constructed by Fibonacci lattice-quantization than using 256 levels of grayscale Using this attribute of Fibonacci lattice-quantization, we can retain color and visual contrast...

Ngày tải lên: 22/06/2014, 19:20

... 10-11 years Research has shown that the parent child associations may be complicated by third variables (such as temperament and parental self-efficacy) and that these variables may vary as a function ... variables and outcome variables are measured at each data collection cycle and incorporated into the statistical models There are several advantages to using GEE for studying population averaged ... the national database LS was responsible for cleaning data, organizing data files, conducting parts of the data analysis and providing conceptual input All authors reviewed and edited the manuscript...

Ngày tải lên: 13/08/2014, 18:21

... endothelial cells, and mouse anti-rat ICAM-1 ( 1A2 9, kindly provided from Dr M Miyasaka, Osaka Univ., Osaka, Japan) as an iso-type control After washing, cells were incubated for one hour with 100 ... incubation Data were normalized to untreated, non-activated control HUVECs arbitrarily set at Results are expressed as the mean ± standard deviation (n = 3) Asterisks indicate p < 0.05 compared with ... Arthritis Research & Therapy Vol No Ogawara et al as stress response, innate and adaptive immune reactions, and apoptosis [5-8] In endothelial cells, NF-κB is activated by inflammatory...

Ngày tải lên: 09/08/2014, 07:20

... The logical and physical implementation of a database necessitates that the data requirements be defined What types of data (at a high level) are going to be stored? " Explicit The data requirements ... to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from...

Ngày tải lên: 10/12/2013, 17:15

... You can push these changes to the database using the following example: mySqlDataAdapter.Update(myDataSet); All your changes to myDataSet are pushed to the database as part of the transaction ... Each of the Command objects in mySqlDataAdapter will now use mySqlTransaction Let's say you added, modified, and removed some rows from a DataTable contained in a DataSet named myDataSet ... mySqlTransaction Note A transaction is rolled back by default; therefore, you should always explicitly commit or roll back your transaction using Commit() or Rollback() to make it clear what your...

Ngày tải lên: 24/12/2013, 01:17

... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY ... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements,...

Ngày tải lên: 17/01/2014, 09:20

... System.EventArgs e) { // Refresh the orders data dt.Clear( ); da.Fill(dt); } Discussion You can use a transaction with a DataAdapter to allow the roll back of updates made by the DataAdapter in ... private const String ORDERS_TABLE = "Orders"; private DataTable dt; private SqlDataAdapter da; private SqlCommandBuilder cb; // private void TransactionDataAdapterForm_Load(object sender, ... da.SelectCommand.Transaction = tran; If custom update logic is used for the DataAdapter, the Transaction must be associated with the DeleteCommand, InsertCommand, and UpdateCommand of the DataAdapter,...

Ngày tải lên: 21/01/2014, 11:20

... The logical and physical implementation of a database necessitates that the data requirements be defined What types of data (at a high level) are going to be stored? " Explicit The data requirements ... to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from...

Ngày tải lên: 24/01/2014, 10:20

... GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala Asn189 fi Ala Arg191 fi Ala Asp192 fi Ala Leu193 fi Ala Leu196 fi Ala The concentrations ... fi Ala Up: CAAGCGCGCTAGTGCTTCGGCAGGCG Down: CGCCTGCCGAAGCACTAGCGCGCTTG Up: CGCTAGTCCTGCGGCAGGCGCATTGG Down: CCAATGCGCCTGCCGCAGGACTAGCG Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG ... Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC...

Ngày tải lên: 07/03/2014, 03:20

... detected with the molybdate reagent, reducing sugars, with aniline hydrogenphthalate; and ribitol and monosaccharides, with 5% (w/v) AgNO3 in aqueous ammonia Acid hydrolysis was carried out with ... & Matthysse, A. G (1997) Attachment of Agrobacterium tumefaciens to carrot cells and Arabidopsis wound sites is correlated with the presence of a cell-associated, acidic polysaccharide J Bacteriol ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined...

Ngày tải lên: 17/03/2014, 10:20

... Gender Male Female Education Illiterate Primary Secondary Tertiary Marital status Single Married—deceased Married—alive Diagnosis COPD CVA RA Parkinson Others Live with whom Family Spouse Alone ... body and mind at ease Although empirical evidence is not available, it has been suggested that Qigong has a similar effect to antidepressants (Yu, 1999) This may be because Qigong practice has an ... Ltd and stronger self-efficacy Paillard and Nowak (1985) reported that an exercise program was able to increase activity tolerance, improve range of motion and mobility, and improve affect and...

Ngày tải lên: 28/03/2014, 19:21

... Meta Data Database File System Users Management 2) managing document content and metadata inside the same database System Document Meta Data Document Documents Database Using a database for management ... mechanisms for configuring ‘compound’ documents Database management systems - Using a database for document management - page Using a database for management If you decide to use a database, ... page Using a database for management There are advantages to using systems that manage both document content and metadata in the same database: Users Management System Document Document Meta...

Ngày tải lên: 31/03/2014, 20:20

... gia nhiệt cho dầu chảy bên ngòai ống khơng gian hình xuyến, sau nước lạnh bơm tuần hòan thơng qua Collector thu nhiệt mặt trời vào tank ch a nhỏ Dầu thơ tuần hòan khơng gian hình xuyến qua quay ... 23, mở van 12, 14 , 15, 16, 17, 19, 20, hai bơm 5A họat động, lúc nước nóng tank lớn gia nhiệt cho tank nhỏ qua dàn ống xoắn để từ nước nóng bên đường ống thiết bị ống lồng ống để gia nhiệt cho ... gia nhiệt thêm cho dầu có họat động hay khơng phụ thuộc vào nhiệt độ dầu vỏ ngòai khơng gian hình xuyến trao đổi nhiệt ống lồng ống, tùy thuộc vào điều kiện thời tiết Điện trở sấy dầu (10) họat...

Ngày tải lên: 29/06/2014, 16:20

Ngày tải lên: 26/07/2014, 13:20

... take the real test TESTING WITH A PARTNER If you’re studying with a partner, make up a test for each other Be sure to make up answer sheets on separate paper and have proof for every correct answer ... best by using images: Draw any images that you associate with the information on each card Use your imagination! • If you learn best by seeing: Tape up your index cards in places you can’t miss, ... create at first Follow this formula for choices: make up four possible answers for each question a correct answer, a nearly correct answer, an answer loosely associated with the right answer, and...

Ngày tải lên: 07/08/2014, 22:20

... to thank Patrick Garnero for pro-MMP-3 assay and Claude Philippe for technical assistance with real-time PCR We are grateful to Francis Raul, in whose laboratory cDNA array experiments Available ... were calculated using a standard curve Statistical analysis Values are represented as means ± standard error of the mean The significance of the results was analyzed using Student's two-tailed ... the synovial tissue of patients with advanced rheumatoid arthritis or osteoarthritis: analysis with gas chromatography-mass spectrometry and pan-bacterial polymerase chain reaction Arthritis...

Ngày tải lên: 09/08/2014, 06:22