2 unstable waves of flame propagation in a closed tube

... domain 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) ... primers: Qa -2, Sense: 5' AGGTCTTAT GGTGCTGTCAC-3', Anti sense: 5'- TGT Page of 12 GTAATTCTGCTCCTTCC -3'; β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; ... 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) 3'-UUACACUACUUAUCCUCCACU5'(antisense) Cytoplasmic membrane domain 5'-UAGAGCUCUGAUAGAUCUCUU-3'(sense) 3'-UUAUCUCGAGACUAUCUAGAG5'(antisense) France, Illkirchcedex), was intravenously...

Ngày tải lên: 11/08/2014, 03:20

... 17. 02 17.86 20 .41 18.83 28 .00 27 .20 21 . 82 22. 14 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 20 .26 28 .00 28 .00 22 .61 20 . 92 21 .20 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 32. 55 28 .00 28 .00 28 .00 26 .86 28 .00 28 .00 ... 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 22 .56 22 .96 28 .00 28 .00 24 .98 28 .00 25 .05 22 .96 26 .26 21 .54 28 .00 28 .00 23 .81 24 .05 28 .00 28 .00 28 .51 28 .00 28 .00 28 .00 22 .65 21 .94 23 .47 ... 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 24 .54 22 .88 28 .00 22 .28 24 .38 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 28 .00 23 .36 28 .00 28 .00 21 .43 28 .00 23 .75 28 .00 28 .00 26 .89 25 .53 28 .22 ...

Ngày tải lên: 09/09/2015, 18:49

... plasmin by plaminogen activators- urokinase plasminogen activators (uPAs) and tissue plasminogen activators (tPAs) (Conaway et al., 20 01) Plasmin has a broad trypsin-like specificity and degrades ... growth factor (VEGF), transcriptionally upregulated in part by hypoxia, mediates an increase in vascular permeability and extravasation of plasma proteins including plasminogen, which can be converted ... with abnormal scarring may face physical, aesthetic, psychological, and social consequences that may be associated with substantial emotional and financial costs (Bayat et al., 20 03; Diegelman and...

Ngày tải lên: 11/09/2015, 10:03

... elastic waves 20 ii 2. 3 DQ and its localizations in one- and two-dimension 20 2. 3.1 DQ and its spatial discretization of the wave equation 21 2. 3 .2 Stability analysis 25 2. 3.3 DQ localization in one ... ∂x ∂x (2. 4 1a) ∂2w ∂ 2u ∂2w = c 21 + c 22 ∂t ∂x ∂x (2. 41b) where 2 c11 = ( ρ 22 P − ρ 12 Q) /( ρ11 ρ 22 − ρ 12 ) , c 12 = ( ρ 22 Q − ρ 12 R) /( ρ11 ρ 22 − ρ 12 ) (2. 4 2a) 2 c 21 = ( ρ11Q − ρ 12 P ) /( ... 15 2. 2 .2 The stress-strain relations in a fluid-saturated porous solid 16 2. 2.3 Dynamic relations in the absence of dissipation 18 2. 2.4 The governing equations of propagation of purely elastic...

Ngày tải lên: 26/09/2015, 09:39

... design and a routine control selection design in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991 As an example, we assessed the hazards of ... in accuracy of the death certificate Third, social class, which is also associated with both smoking and cancer deaths, was not measured in this study, and the separate calculation of risk patterns ... et al Cigarette smoking and exposure to environmental tobacco smoke in China: the international collaborative study of cardiovascular disease in Asia Am J Public Health 20 04; 4: 19 72 6 Deng J...

Ngày tải lên: 26/10/2012, 09:48

... m_ghazikhani@Ferdowsi.um.ac.ir M Ahmadzadehtalatapeh is Master of Science in Mechanical Engineering He is lecturer in Chabahar Maritime University, IRAN His main research interests are heat exchangers ... Mechanical Engineering, Ferdowsi University of Mashhad, IRAN His main research interests are internal combustion engines and power plant analysis based on thermodynamic laws E-mail address: m_ghazikhani@Ferdowsi.um.ac.ir ... Bolatturk A Performance and parametric investigation of a binary geothermal power plant by exergy Renew Energ., 20 08, 33, 23 66 -23 74 ISSN 20 76 -28 95 (Print), ISSN 20 76 -29 09 (Online) 20 10 International...

Ngày tải lên: 05/09/2013, 16:11

... overload used in the sample takes two arguments, the data source and the data member, because the data source is a DataSet For a DataTable, an overload of the BindingContext indexer is used that takes ... While a RadioButton control can be set to simple-bind to data, there is no way to bind a group of RadioButton controls to a data source Binding a single radio button to a data source isn't a particularly ... the data source argument Attach an event handler for the PositionChanged event of the BindingManagerBase This event indicates that the selected row in the DataTable has changed bm.PositionChanged...

Ngày tải lên: 07/11/2013, 13:15

... boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) separate the “pairs of pants” Figure 4: Decomposing the Riemann examples ... stability inequality applied to φ χ and the inequality, 2ab ≤ a2 + b2 , (II.1.6) T1,R |A |2 [(R − r)/(R − 1) ]2 ≤ |A |2 2 ≤ |∇φ |2 + TR |∇χ |2 + TR ∩{χ

Ngày tải lên: 14/02/2014, 17:20

... change, and language relationship: An introduction to historical and comparative linguistics Berlin, New York: Mouton de Gruyter Andrew Kachites McCallum 20 02 Mallet: A machine learning for language ... mixed-lingual data with an application to parsing Ph.D thesis, Institute for Communicating and Collaborative Systems, School of Informatics, University of Edinburgh Eduardo G Altmann, Janet B ... (McCallum, 20 02) to train a maximum entropy classifier, using character 1- through 6-grams (including word boundaries) as features Since we could not manually annotate a large portion of the MZEE...

Ngày tải lên: 19/02/2014, 19:20

... treatment of quantification in ordinary English" (PTQ), in J Hintikka, J Moravesik, and P Suppes (eds.) (1973) Approaches to Natural Language, D Reidel, Dordrecht, 22 1 -24 2; reprinted in R Montague ... with a table that contains each ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, the correct denotational relationship ... propositional attitudes This mechanism is a correlate of that of Thomason [1980], with the addition of meaningful names to intensional objects serving the same p u r p o s e as Thomason's a d d i...

Ngày tải lên: 21/02/2014, 20:20

... rising the use of a combination of Pancreatin and Cetavlon for the routine cultivation of tubercle bacilli: Indian Jour Tuberc., 76-86 Raj Narain, A. Gaser, M.V.Jambunathan and M.Subramanyan (1963) ... possible reason (s) As intra-reader variation of NTI technician, in classifying a certain proportion of smears as positive, may not be high between re-examination and duplicate smear examination (and ... smear Positives No Col.4 % to Col.4 Devanahalli 439 407 101 24 .8 79 19.4 Doddahejjaji 27 8 25 4 21 8.3 22 8.7 Sulebele 199 1 82 23 12. 6 23 12. 6 Bidadi 193 178 22 12. 4 2. 8 Vijayapura 133 123 15 12. 2...

Ngày tải lên: 06/03/2014, 04:20

... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are ... Model of Constitutionalism’ (20 01) 49 American Journal of Comparative Law 707–60, for a detailed analysis of these features Jos´ Mar a Maravall and Adam Przeworski (eds.), Democracy and the Rule of ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent...

Ngày tải lên: 07/03/2014, 02:20

... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are ... Model of Constitutionalism’ (20 01) 49 American Journal of Comparative Law 707–60, for a detailed analysis of these features Jos´ Mar a Maravall and Adam Przeworski (eds.), Democracy and the Rule of ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent...

Ngày tải lên: 07/03/2014, 02:20

... 52 29 100 80 80 79 80 49 50 32 AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 AACEVAPD2 AACEVAPD3 AACEVAPD1 ... cDNAs varies (AAC EVAPD1, 736 bp; AACEVAPD2, 825 bp, AACEVAPD3, 10 32 bp; AACEVAPD4, 7 52 bp; AACEVAPD5, 722 bp; AACEVAPD6, 826 bp), and the sequences of their 50 and 30 untranslated regions are ... for AACEVAPD5 and pVC74/pVC74N for AACEVAPD6 ) [7,8] were subjected to PCR with primer sets of AP2 and adaptor for AACEVAPD1, AP2 and adaptor for AACEVAPD2, AP2 both at 50 and 30 ends for AACEVAPD3–6,...

Ngày tải lên: 08/03/2014, 23:20

... |∇w|4 − |A |2 |∇w |2 − | A |2 Since the Jacobi equation is the linearization of the minimal graph equation over Σ, analogs of (II .2. 8) and (II .2. 9) hold for solutions of the minimal graph equation over ... domains, Ann of Math., to appear; math.AP/ 021 0141 [CM6] ——— , The space of embedded minimal surfaces of fixed genus in a 3-manifold IV; Locally simply connected, Ann of Math., to appear; math.AP/ 021 0119 ... separation w = π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equation GRAPHICAL OFF THE AXIS 29 x3 -axis One half rotation Figure 2: The helicoid...

Ngày tải lên: 14/03/2014, 22:20

... consisting of rifampicin, isoniazid and pyrazinamide The duration of treatment usually lasts 6-8 months [(n=36; 95%) (Table 5)] Table Physicians’ approach in the diagnosis of PTB Yes CXR alone ... presence of intrathoracic or extra thoracic lymphadenopathies, anemia and leukocytosis may also increase our suspicion of tuberculosis.7 The National Tuberculosis Program (NTP) of the government as ... by 92% (n= 32) and 3-drug by the remaining 8% (n=3) In an article by Rivera et al,9 the rates of MDR-TB in the Philip-pines are similar to the weighted mean of 4.3% combined, 2. 1% primary and...

Ngày tải lên: 15/03/2014, 03:20

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC ... B1 ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ... GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC...

Ngày tải lên: 16/03/2014, 16:20