2 1 ga and one point crossover

Báo cáo y học: " Simultaneous detection and differentiation by multiplex real time RT-PCR of highly pathogenic avian influenza subtype H5N1 classic (clade 2.2.1 proper) and escape mutant (clade 2.2.1 variant) lineages in Egypt" potx

Ngày tải lên : 12/08/2014, 01:22

... CTG Conc .1 (nM) Position2 400 16 15 -16 41 P1FW _2. 2.1v GAA TCA ATA GGA ACT TAC CAA ATA CTA TC 800 16 15 -16 43 P1RV _2. 2 .1 AGA CCA GCC ACC ATT GAT TGC 400 16 99 -16 79 PRO1 .1 _2. 2.1v PRO1 .2_ 2 .2. 1p FAM-ACA ... CT-BHQ -1 HEX-ACA GTG GCG AGC TCC CTA GC-BHQ -1 64 64 Amplificate size (bp) 16 54 -16 70 16 52- 16 75 P2FW _2. 2.1p GGA TTC ACC ATC CRA ATG ATGC 16 00 620 -6 41 P2FW _2. 2.1v GGG ATT CAC CAT CCA AAT GAT GA 16 00 619 -6 41 ... GA 16 00 619 -6 41 P2RV _2. 2.1p CCG TTT ACC TTA GAT CTA GTA GCT ATT 16 00 7 52- 726 P2RV _2. 2.1v CCG TTT ACC TTA GAT CTA GTR GCT ATC 16 00 7 52- 726 10 PRO2 _2. 2 .1 ROX -TAC CTA TAT TTC CGT TGG GAC ATC AAC...

8
295
0

Climate change as environmental and economic hazard - phần 2.1

Ngày tải lên : 07/10/2012, 15:57

... HAZARDS (20 09) 20 9 22 5 doi :10 .3763/ehaz .20 09.0 023 # 20 09 Earthscan ISSN: 17 47-78 91 (print), 18 78-0059 (online) www.earthscanjournals.com 21 0 Botzen and van den Bergh FIGURE Overall and insured ... require a decrease in UK greenhouse gas emissions of 2. 8 per cent per annum between 20 07 and 20 20 This would have to increase to 3.5 per cent per annum between 20 20 and 20 50 Although the initial reduction ... Pierrehumbert, 20 04) The Intergovernmental Panel on Climate Change (IPCC) projects a rise in global average surface temperatures between 1. 1 and 2. 98C in 21 00 for a low-emission scenario and between 2. 4 and...

8
639
0

GA tuan 14 lop 2 +1 ( ngang ) CKTKN

Ngày tải lên : 19/10/2013, 22:11

... nêu phép trừ 11 – = 12 – = 17 – = 18 – = 17 – = 11 – = 12 – = … … 14 – = 15 – = 14 – = 15 – = - GV nxét -Tổ chức HS đọc thuộc lòng bảng trừ * Bài 2( cột 1) : Tính HS sửa tiếp sức Yêu cầu nêu cách ... nhở em chưa cố gắng ……………………………………………………………………… Thứ tư ngày 24 tháng 11 năm 20 10 Tiết : – Mơn : Học vần Bài 55: ang anh TCT : 12 3 - 12 4 A Mục tiêu - HS đọc được: ang – anh – bàng – cành chanh; ... 68 LUYỆN TẬP I MỤC TIÊU: - Thuộc bảng 15 , 16 , 17 , 18 trừ số - Biết thực phép trừ có nhớ phạm vi 10 0, dạng học - Biết giải toán - BT cần làm : B1 ; B2 (cột 1 ,2) ; B3 ; B4 II CHUẨN BỊ: - Bảng phụ,...

30
348
0

Differences Between ActionScript 1.0 and 2.0

Ngày tải lên : 24/10/2013, 12:15

... lesson, we'll look at both the Actions panel and the stand-alone ActionScript editor There are other differences between ActionScript 1. 0 and ActionScript 2. 0, but this brief overview should provide ... as possible, Flash MX 20 04 now provides a stand-alone ActionScript editor, which is separate from the Actions panel, and which is used for nothing more than the creation and saving of as files ... in detail at this point) , you'll quickly see its benefits over ActionScript 1. 0 Another subtle difference in creating custom classes of objects between ActionScript 1. 0 and 2. 0 is that the script...

7
481
2

Tài liệu PRIVATE ENTREPRENEURS IN CHINA AND VIETNAM PART 2-1 ppt

Ngày tải lên : 15/12/2013, 06:15

... staff 8 -20 21 -50 51- 100 10 1 -20 0 20 1- 500 5 01- 1.000 1. 0 01 -2. 000 2. 000 Total Hangzhou Number % 12 17 .9 16 23 .9 16 23 .9 13 19 .4 10 .4 3.0 0.0 1. 5 67 10 0.0 Luohe Number % 13 21 .7 19 31. 7 16 26 .7 10 .0 ... Chemistry 10 Furniture 11 Toys 12 Metal goods 13 Mining 14 Others Total % Number % Number % 14 12 11 2 1 69 20 .3 17 .4 15 .9 13 .0 2. 9 10 .1 1.5 7 .2 2.9 2. 9 1. 5 1. 5 0.0 2. 9 10 0.0 4 11 30 0 1 0 60 6.7 ... Vietnam Number % 5.7 0.0 20 .0 11 .4 8.6 17 .1 0.0 5.7 2. 9 11 .4 8.6 2. 9 2. 9 2. 9 35 10 0 .1 South Vietnam Number % 1 .2 0.0 3.5 13 15 .1 20 23 .3 2. 3 1 .2 15 17 .4 8 .1 7.0 3.5 5.8 5.8 5.8 86 10 0.0 LOCALITIES;...

27
529
0

Tài liệu Lab 3.1.2 Command Modes and Router Identification docx

Ngày tải lên : 18/01/2014, 04:20

... Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 25 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 26 00 ... 3.0 - Lab 3 .1 .2 Copyright  20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) ... Router(config-if)#exit 2- 5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3 .1 .2 Copyright  20 03, Cisco Systems, Inc Step Assign a name to the router a Router(config)#hostname GAD b What prompt did...

5
411
0

Tài liệu Lab 3.1.2 Command Modes and Router Identification doc

Ngày tải lên : 18/01/2014, 04:20

... Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 25 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 26 00 ... 3.0 - Lab 3 .1 .2 Copyright  20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) ... Step Exit the router 2- 5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3 .1 .2 Copyright  20 03, Cisco Systems, Inc a Enter exit at the prompt to close out of the router GAD(config)#exit Upon...

5
332
0

Tài liệu Similarities Between Actionscript 1.0 and 2.0 pptx

Ngày tải lên : 26/01/2014, 11:20

... And scripts can still be assigned to button and movie clip instances using the on() and onClipEvent() event handlers < Day Day Up > ...

2
351
1

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20

... mmol, 14 %) 1H NMR d 7.6–7.9 (m (16 H, P+–ArH and H -11 ), 7.46 (1H, s, H-6), 6.49 (1H, s, H-9), 4 .1 4 .2 (2H, m, Ar-O-CH2), 3. 71 (3H, s, O-CH3), 3.4– 4.0 (5H, m, P+–CH2, H -11 a and H-3), 1. 75 2. 4 (8H, ... 1. 75 2. 4 (8H, m, O-CH2-CH2, P+–CH2-CH2, H -1 and H -2) p.p.m., 31 PNMR d 25 .65 p.p.m ESMS found (M+) 563 .24 69 calculated for C35H36O3N2P (M+) 563 .24 58 H (300 MHz) and 31P ( 12 1 MHz) NMR spectra were ... replication and expression (Fig 1) For the DNA alkylating reagent we chose the antibiotic (11 aS)-8hydroxy-7-methoxy -1 ,2, 3 ,11 a-tetrahydro-5H-pyrrolo [2, 1c] [1, 4]benzodiazepin-5 -one; (DC- 81) [1 ,25 ] This...

10
638
0

UNIT 2. UNDERSTANDING NEEDS AND ASSESSING OPPORTUNITIES LESSON 1. INTRODUCTION TO NEEDS ANALYSIS doc

Ngày tải lên : 08/03/2014, 20:20

... support and capacity building • Activities that will enhance sustainability of the initiatives • New technology and equipment, telephone and Internet connection, content development, networking and ... very similar This results in repetitions and, considering the high costs of telephone communications, in poor use of time and money A different approach and a multidirectional communication channel ... process See Annex 2. 1. 1 for a mini-lesson on using a logical model The role of the needs analysis Understanding user’s needs is crucial in defining what you are trying to achieve and what will happen...

9
428
0

UNIT 2. UNDERSTANDING NEEDS AND ASSESSING OPPORTUNITIES LESSON 1. INTRODUCTION TO NEEDS ANALYSISNOTE doc

Ngày tải lên : 08/03/2014, 20:20

... support and capacity building • Activities that will enhance sustainability of the initiatives • New technology and equipment, telephone and Internet connection, content development, networking and ... very similar This results in repetitions and, considering the high costs of telephone communications, in poor use of time and money A different approach and a multidirectional communication channel ... process See Annex 2. 1. 1 for a mini-lesson on using a logical model The role of the needs analysis Understanding user’s needs is crucial in defining what you are trying to achieve and what will happen...

9
340
0

Báo cáo khoa học: Copines-1, -2, -3, -6 and -7 show different calcium-dependent intracellular membrane translocation and targeting pdf

Ngày tải lên : 29/03/2014, 21:20

... 5¢-GTTTCTGAATTCTGGCCAC CATGGCCTACATTCCGGATGGG-3¢ and 5¢-GTTTCT GGATCCGCGCTTTTCTTCTTCCTCTGCTTCTTGG-3¢ (C2C2–copine -2) , and 5¢-GTTTCTGAATTCTGGCCACC ATGTCGGACCCAGAGATGGGATG-3¢ and 5¢-GTTTC TGGATCCAGCTTGTAATTCTTCTTCTTGTCTCGGTA ... C2C2–copine -2* construct For the C2A6* chimaera, containing the copine-6 linker between the C2C2- and vWA-domains, the PCR ampliﬁcation product (5¢-GTTTCTGGATCCAAAGTACCGAGACAA GAAGAAGAATTACAAGAG-3¢ ... Fulllength copine -2 EYFP and its C2C2-EYFP domain responded similarly to methacholine in the presence (P = 0.59; n1 = 25 4, n2 = 18 7; U-test) or absence (P = 0. 31; n1 = 24 0, n2 = 17 3; U-test) of...

16
273
0

Báo cáo hóa học: "Research Article Time-Frequency and Time-Scale-Based Fragile Watermarking Methods for Image Authentication Braham Barkat1 and Farook Sattar (EURASIP Member)2 1 Department 2 Faculty" pdf

Ngày tải lên : 21/06/2014, 08:20

... left eye region) 1 137 14 4 25 6 Magnitude of the extracted chirp signal 1. 3 1 .25 1 .2 12 9 (13 5, 13 8) 1. 15 13 6 1. 1 14 4 16 × authentication block with index 28 1 1.05 0.95 50 10 0 15 0 20 0 25 0 300 350 400 ... 15 .74 80% 35.94 0.06 41 11. 93 70% 34. 41 0.0956 10 .19 60% 33.34 0 .10 61 9.74 50% 32. 56 0. 12 2 7 9 .11 w mag (i) − , Nw i =1 given by 26 7, 26 8, 28 3, 28 4, 29 9, 300, 315 , 316 , 3 31, and 3 32, exactly match the ... chirp signal 1. 3 1 .2 Pixel location (16 1, 12 9 ) 1. 1 Block index 26 7 28 3 29 9 315 3 31 28 4 300 316 3 32 (16 1, 16 8) 0.9 0.8 16 × authentication block 0.7 0.6 0.5 0.4 0.3 50 10 0 15 0 20 0 25 0 300 350 400...

14
377
0

Portable Flash Intro and Banner Maker 2.1.90 pot

Ngày tải lên : 22/07/2014, 12:20

... mã HTML bao gồm Flash movie bạn để nhúng vào website Publish Gọn nhẹ lợi ích mang lại vô lớn có 2, 1 MB Còn đợi nữa, tải xuống PFIABM khám phá Chúc bạn vui ! ... Để chế độ Transparent, Solid corlor Gradient color tùy thuộc vào sở thích bạn + Background image and Flashmovie: PFIABM cho phép dùng ảnh cá nhân để làm background, đồng thời cho chèn đoạn Flash...

7
343
0

Báo cáo khoa học: "Prognostic significance of IDH-1 and MGMT in patients with glioblastoma: One step forward, and one step back" pot

Ngày tải lên : 09/08/2014, 09:21

... Science 20 08; 3 21 :18 07- 12 21 Watanabe T, Nobusawa S, Kleihues P, Ohgaki H IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas Am J Pathol 20 09 ;17 4 :11 49-53 22 Yan ... Anti-seizure medication – no (%) yes no 66 ( 41) 94 (59) Sex – number (%) 11 5 ( 72) 45 (28 ) 43 (27 ) 51 ( 32) 66 ( 41) 33 ( 21 ) 90 (56) 37 (23 ) 24 7-98 11 3 ( 71) 47 (29 ) 75 (47) 85 (53) Figure Figure Figure ... IDH -1 and MGMT in patients with glioblastoma: One step forward, and one step back? Stephanie E Combs1, Stefan Rieken1, Wolfgang Wick2, Amir Abdollahi1, Andreas von Deimling3,4, Jürgen Debus1 and...

18
365
0

Báo cáo y học: "Expression of novel extracellular sulfatases Sulf-1 and Sulf-2 in normal and osteoarthritic articular cartilage" pdf

Ngày tải lên : 09/08/2014, 10:23

... Res 20 01, 3 91( Suppl):S108 -11 5 Sandell LJ, Aigner T: Articular cartilage and changes in arthritis An introduction: cell biology of osteoarthritis Arthritis research 20 01, 3 :10 7 -11 3 Sauerland K, ... signalling Nature 19 99, 400 :28 1 -28 4 Lin X, Buff EM, Perrimon N, Michelson AM: Heparan sulfate proteoglycans are essential for FGF receptor signaling during 17 18 19 20 21 22 23 24 Drosophila embryonic ... growthassociated molecule (HB-GAM) J Cell Biol 19 98, 14 3 :11 13 -1 12 8 Tesche F, Miosge N: Perlecan in late stages of osteoarthritis of the human knee joint Osteoarthritis Cartilage 20 04, 12 : 8 52- 8 62 Hayes AJ, Tudor...

8
388
0

Báo cáo y học: " Quantitative PCR used to Assess HIV-1 Integration and 2-LTR Circle Formation in Human Macrophages" potx

Ngày tải lên : 12/08/2014, 02:20

... immunodeficiency virus -1 (HIV -1) J Clin Invest 19 92, 89 :17 6 -18 3 Butler SL, Hansen MS, Bushman FD: A quantitative assay for HIV DNA integration in vivo Nat Med 20 01, 7:6 31- 634 doi :10 .11 86 /17 43- 422 X-7-354 Cite ... 19 93, 67 :11 69 -11 74 10 Stevenson M, Stanwick TL, Dempsey MP, Lamonica CA: HIV -1 replication is controlled at the level of T cell activation and proviral integration Embo J 19 90, 9 :15 51- 1560 11 ... Virol 20 01, 75 :1 12 5 3 -1 12 6 0 17 Yamamoto N, Tanaka C, Wu Y, Chang MO, Inagaki Y, Saito Y, Naito T, Ogasawara H, Sekigawa I, Hayashida Y: Analysis of human Friedrich et al Virology Journal 20 10 , 7:354...

6
370
0

Báo cáo y học: "Case report: Severe mercuric sulphate poisoning treated with 2,3-dimercaptopropane-1-sulphonate and haemodiafiltratio" ppt

Ngày tải lên : 12/08/2014, 19:22

... (h) 15 .2 0 .10 5 3 .18 0.0 12 1 0 .27 3 0.0 016 1. 74 3 81 6.60 57 .2 425 25 Data set 28 14 15 47 51. 3 9 .14 37.5 28 .5 15 .3 51 .2 3.66 0. 013 9 0. 318 0.0 019 2. 33 5 72 50.0 3 62 10 .2 10 .7 32. 3 32. 4 4.98 23 .1 10.6 ... 19 81, 18 :26 1 -26 6 Hurlbut KM, Maiorino RM, Mayersohn M, Dart RC, Bruce DC, Aposhian HV: Determination and metabolism of dithiol chelat- R5 Critical Care 10 11 12 13 14 15 16 17 18 19 R6 June 20 03 ... Williams and Wilkins; 19 84 :26 2 -27 5 Winship KA: Toxicity of mercury and its inorganic salts Adv Drug React Ac Pois Rev 19 85, 3: 12 9 -16 0 Gabard B: The excretion and distribution of inorganic mercury...

6
243
0

Báo cáo y học: "HIV-1 Vpu and HIV-2 Env counteract BST-2/tetherin by sequestration in a perinuclear compartment" pot

Ngày tải lên : 13/08/2014, 01:20

... alphaadaptin J Biol Chem 20 09, 28 4 :15 927 -15 9 41 31 Bieniasz PD: Intrinsic immunity: a front-line defense against viral attack Nat Immunol 20 04, 5 :11 09 -11 15 32 Margottin F, Bour SP, Durand H, Selig L, Benichou ... HIV -1 Vpu [3,4], HIV -2 Env [13 ], SIV Nef [14 -17 ], KSHV K5 [19 ] and Ebola GP [ 12 ] These observations suggest Hauser et al Retrovirology 20 10 , 7: 51 http://www.retrovirology.com/content/7 /1/ 51 Page ... Vpu-mediated enhancement of HIV -1 particle release Traffic 20 06, 7 :29 8-307 doi: 10 .11 86 /17 42- 4690-7- 51 Cite this article as: Hauser et al., HIV -1 Vpu and HIV -2 Env counteract BST -2/ tetherin by sequestration...

16
264
0

Báo cáo y học: " Human TRIM5α mediated restriction of different HIV-1 subtypes and Lv2 sensitive and insensitive HIV-2 variants Patrick Kaumanns, Isabel Hagmann and Matthias T " pps

Ngày tải lên : 13/08/2014, 09:20

... [VSV-G] 1, 0 1, 0 0 ,1 0 ,1 100 10 00 10 3 10 000 10 4 10 0,0 10 0,0 % of maximum RLU B 10 ,0 10 ,0 HIV -2 [VSV-G] HIV -2/ I73V [VSV-G] HIV -2 [VSV-G] HIV -2/ I73V [VSV-G] 1, 0 1, 0 0 ,1 0 ,1 100 10 00 10 3 10 000 10 4 10 0,0 ... Retrovirology 20 06, 3:79 http://www.retrovirology.com/content/3 /1/ 79 19 .5 25 A 20 18 .4 fold restriction 16 .6 15 10 5.3 2. 9 2. 8 1. 7 1. 9 1 .2 1 .2 UG 0 21 BD6 UG 029 NL 4.3 D 117 20 44 ELI B A B 20 05 D MVP 217 1 AG ... 10 0,0 10 0,0 % of maximum RLU C 10 ,0 10 ,0 HIV -2 [Env42S] HIV -2/ I73V [Env42S] HIV -2 [Env42S] HIV -2/ I73V [Env42S] 1, 0 1, 0 0 ,1 0 ,1 100 10 00 10 3 10 000 10 4 infectious units Figure (A) VSV-G envelope and...

7
227
0