2—examples of centerline cracking see c 3 7 2

... Overview of C# The Class Topic Objective To point out that every C# application is a collection of classes Lead-in A C# application is a collection of one or more classes A C# application is a collection ... A block comment starts with the /* character pair and continues until a matching */ character pair is reached You cannot nest block comments Module 2: Overview of C# 17 Generating XML Documentation ... Overview of C# 23 Invoking the Compiler Topic Objective To describe how to compile a C# application and the different compiler options that are available Common Compiler Switches Compiling from the Command...

Ngày tải lên: 22/10/2013, 16:15

... Oligonucleotides used in this study were: PF, 5¢-CGGGATC CGGTGGCGACGACTCCTGGAGCCC -3 ; PR, 5¢-CG GGATCCCAACTGGTAATGGTAGCGACCGGC -3 ; P2-1, 5¢-ATGGAYATHGCIACIACICARGC -3 ; P2 -2, 5¢-TAGCAACTCATTCGTCACTGTC -3 ; ... ? [AT5g1 576 0] AF 23 6 826 [AT2g38140] BE 0 37 671 [AT3g56910] AV 5 32 73 7 [AT5g 178 70] BF2 626 51 BF2 679 82 AW20 124 2 AW56 121 5 ? Z98114 AV390148 ? BG8 470 93 P74518 NI Q5 538 5 BE55 87 13 BF 621 665 BG30 038 7 AW598994 ... 5¢-TAGCAACTCATTCGTCACTGTC -3 ; P2 -3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC AAAATC -3 ; P2-4, 5¢-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC -3 ; P3-1, 5¢-ATGG GIAAYGARGTIGAYATHG -3 ; P3 -2, 5¢-CTAGACC TATGTTTTTCTCCATCC -3 ;...

Ngày tải lên: 17/03/2014, 09:20

... convertase ⁄ (mPC1 ⁄ 3) CT-peptide corresponding to positions 5 92 72 6 FEBS Journal 27 4 (20 07) 34 82 34 91 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 34 83 Bimodal regulation of proprotein convertase ... Biol Chem 27 0 , 21 509 21 516 36 Muller L, Cameron A, Fortenberry Y, Apletalina EV & Lindberg I (20 00) Processing and sorting of the prohormone convertase propeptide J Biol Chem 27 5 , 39 2 13 39 22 2 37 ... Fuller RS (20 02) Speci c modulation of Kex2 ⁄ furin family proteases by potassium J Biol Chem 27 7 , 17 531 – 17 5 37 33 Cieplik M, Klenk HD & Garten W (1998) Identification and characterization of Spodoptera...

Ngày tải lên: 30/03/2014, 08:20

... 5¢-TACCGCGGTCAAAATCACCCTCC GTTCTCGAGCAGTGGAGACGCGTGA -3 ; rACT6 .3, 5¢-TACCGCGGTCAAAATCACCAGGAGGTCTATC GATGTGGAGACGCGTGA -3 ; rACT8 .3, 5¢-TACCGCG GTCAAAATCAGGGGGAGATCTGAGTTAGTGGA GACGCGTGA -3 ; rACT6 .7, 5¢-TACCGCGGTCAAAAT ... 5¢-TACCGCGGTCAAAAT CAAGCTTAGAACAACATTAGTGGAGACCGCTG A -3 ; rACT6.1, 5¢-TACCGCGGTCAAAATCATGACAA GATCTAACTTAGTGGAGACGCGTGA -3 ; rACT5.18, 5¢-TACCGCGGTCAAAATCACCGAGCGTGTCTCG CCCGTGGAGACGCGTGA -3 (where ... HNE 105 134 150 33 4 177 9 905 424 158 25 – 18 – 626 1 – 62 17 – 34 – – – 2 439 – – – – 27 7 – 8991 – 20 1 – 19 – 16 159 34 42 – 8 024 11 92 139 – – – 595 – – – – – – – 6 129 5 – – Ó FEBS 20 04 Human kallikrein...

Ngày tải lên: 30/03/2014, 13:20

Ngày tải lên: 21/07/2014, 17:20

... into classes or categories according to specific characteristics (NOTE: classifies – classifying – classified) clause noun /klɔ z/ a section of a con- tract ć There are ten clauses in the contract ... form of coins or notes í verb ˽ to cash a cheque to exchange a cheque for cash cashable / k ʃəb(ə)l/ adjective which can be cashed ć A crossed cheque is not cashable at any bank cash account ... country because of lack of confidence in that country’s economic future ‘…issued and fully paid capital is $100 million, comprising 23 4 0 shares of $100 each and 9 97, 660 ordinary shares of $100 each’...

Ngày tải lên: 05/08/2014, 13:20

... into a current account Also called cheque account (NOTE: The US term is checking account.) an account of the balance of payments of a country relating to the sale or purchase of raw materials, ... economical ˽ economical car a car which does not use much petrol ˽ an economical use of resources the fact of using resources as carefully as possible economic crisis / i kənɒmk krass/, economic depression ... particular have cyclical exposure without price power’ [Investors Chronicle] cyclical factors / sklk(ə)l f ktəz/ plural noun the way in which a trade cycle affects businesses cyclical stocks / sklk(ə)l...

Ngày tải lên: 05/08/2014, 13:20

... torn: 3. 4 .2 .7) Monophthongisation of ME diphthongs except /oi/ (boy), /ui/ (join), /iu/ (new), /u/ (dew: 3. 4 .2. 13. 4 .2. 2, 3. 4 .2. 4, 3. 4 .2. 6) (b) (c) (d) (e) These changes require some historical context; ... theories of punctuation, part of Treip (1 970 ) is relevant; for an account of the development of one specic feature see Salmon (1996 [19 82] ), and for a general account of punctuation theory 15001800 see ... pronounce it grait (Boswell, 28 March 177 2) Johnson is recalling an incident of 174 7; Flint in 174 0 had already characterised /e / in ME / / words as a Hibernicism (as it still is) ME / / words increasingly...

Ngày tải lên: 05/08/2014, 14:20

Ngày tải lên: 07/08/2014, 10:20

... of fetus with CP 0 1 (3. 33) 1(5.88) No of mother 5 4 No of fetus 41 44 32 30 17 40 No of early died fetus 1 (2. 44) 1 (2. 27 ) 2( 6 .25 ) 4( 13. 33) 2( 17. 76) No of late died fetus 0 0 No of fetus with CP ... with CP 0 1(1 . 72 ) 1(1.61) No of mother 5 No of fetus 57 51 42 57 48 80 No of early died fetus 5(8 .77 ) 2 (3. 92) 4(9. 52) 7( 12. 28) No of late died fetus 2 (3. 92) 3( 5 .26 ) 1 (2. 08) No of fetus with CP ... 2( 5.56) No of late died fetus 1 (3. 45) 1 (2 .7) 1(4.0) No of fetus with CP 0 0 No of mother 5 2 No of fetus 14 38 30 16 17 20 No of early died fetus 3( 21 . 43) 2( 5 .26 ) 3( 10.0) 2( 12. 5) 4( 23 . 53) No of late...

Ngày tải lên: 07/08/2014, 14:23

... 5´-TGACCCATGTGAGCTGAAAG 3 -GACTTGGCAGAGGACAAAGG 499 IL-6 5´-CCACCCACAACAGACCAGTA 3 -GAGCATTGGAAGTTGGGGTA 498 TNFα 5´-GCTCCCTCTCATCAGTTCCA 3 -CGGAGAGGAGGCTGACTTTC 501 IFNγ 5´-GCGGCTGACTGACTGAACTCAGATTGTAG ... Fortmeyer H, Schlatterer B, Hagenmaier H, Chandra P Cell transforming and oncogenic activity of 2 ,3, 7, 8-tetrachloro- and 2 ,3, 7, 8tetrachlorodibenzo-p-dioxin Anticancer Res 19 92, 12, 20 53- 20 60 21 Prell ... transcription reaction, 63. 5 ㎕ of H2O, 0.5㎕ of 5U/㎕ DNA Tag polymerase, 6㎕ of 25 mM MgCl2, 8l of 10×PCR buffer, 1㎕ of each primer (100pmoles) PCR conditions were: 30 cycles of 30 s at 94℃, 30 s...

Ngày tải lên: 07/08/2014, 15:20

... IEEE.Std_logic_1164.all; entity HCT 139 is port(A2, B2, G2BAR, A1, B1, G1BAR : in std_logic; Y20, Y21, Y 22, Y 23 , Y10, Y11, Y 12, Y 13 : out std_logic); end HCT 139 ; architecture VER1 of HCT 139 is begin ... ENTITY cntr3 IS PORT(clock : IN BIT; count : OUT NATURAL); END cntr3; ARCHITECTURE using_wait OF cntr3 IS BEGIN PROCESS BEGIN WAIT UNTIL (clock'EVENT AND clock = '1'); WAIT UNTIL clock = '1'; count ... (clock'EVENT AND clock = '1'); WAIT UNTIL clock = '1'; count

Ngày tải lên: 07/08/2014, 23:20

... => acca := acca - accb; WHEN inc => acca := inc_bv(acca); WHEN dec => acca := dec_bv(acca); WHEN land => acca := acca AND accb; WHEN lor => acca := acca OR accb; WHEN cmp => acca := NOT acca; ... => acca := acca XOR accb; WHEN lita => acca := acca; WHEN litb => acca := accb; WHEN clra => acca := (OTHERS => '0'); WHEN lda|ldb|sta|stb => address acca...

Ngày tải lên: 07/08/2014, 23:20

... IEEE.Std_logic_1164.all; entity HCT 139 is port(A2, B2, G2BAR, A1, B1, G1BAR : in std_logic; Y20, Y21, Y 22, Y 23 , Y10, Y11, Y 12, Y 13 : out std_logic); end HCT 139 ; architecture VER1 of HCT 139 is begin ... ENTITY cntr3 IS PORT(clock : IN BIT; count : OUT NATURAL); END cntr3; ARCHITECTURE using_wait OF cntr3 IS BEGIN PROCESS BEGIN WAIT UNTIL (clock'EVENT AND clock = '1'); WAIT UNTIL clock = '1'; count ... (clock'EVENT AND clock = '1'); WAIT UNTIL clock = '1'; count

Ngày tải lên: 08/08/2014, 01:21

... => acca := acca - accb; WHEN inc => acca := inc_bv(acca); WHEN dec => acca := dec_bv(acca); WHEN land => acca := acca AND accb; WHEN lor => acca := acca OR accb; WHEN cmp => acca := NOT acca; ... => acca := acca XOR accb; WHEN lita => acca := acca; WHEN litb => acca := accb; WHEN clra => acca := (OTHERS => '0'); WHEN lda|ldb|sta|stb => address acca...

Ngày tải lên: 08/08/2014, 01:21

... restriction enzymes 11 12 13 1 122 G>A 129 3T >C2 129 6T >C2 30 30G>A T 329 T F382F D383D T961T 3/ 26 2 7 /35 0 1 43/ 26 2 1/16 63 3/1 62 4 / 32 4 96/186 0/18 03 0.55 0.68 0 .78 0.51 BanI PfIFI TaqI - 27 1Numbering according ... CGCACATGTATCCAGAACT CAAAGAAGATAAGGGCAGGC AGGAGTTCGAGAAGAGCCTG TGATCTGTGTCTGGGCTTTC antisense *nucleotide marker AGAGGTGGACCCATGCTTA CCTAGGCGACTCAGTGAGACT TGCCACTACACCCAGATGAT AGTTGTGACCCTAACATTGCA ... *di (AC) *di (AC) fluorescence labelled tail (5-Fam-CATCGCTGATTCGCACAT) was added to the 5'end of each sense primer release proteolytic enzymes after activation with PR3ANCA [4] The consequence...

Ngày tải lên: 11/08/2014, 08:20

... (KF2 - TTCACGCAGAA AGC GTCTAG and 21 1-CACTCTCGAGCAC CCTATCAGGCAGT) and NS5b (HCVN S5F2-TATGA TACC CGCTGCTTTGACTCG; HCVNS 5R 2c- CTGG TCATAGCCTCCGTGAAGGCTCTCAGG and HCVN S5 R2d-CTGGTCATAGCCTCCGTGAAGGCTCGTA ... (26 .3) Female 116 (60 .7) 30 5 (79 .8) 421 ( 73 . 6) Age1 0-9 years 27 (14 .2) (0.0) 27 (4 .7) 10 -24 years 10 (5 .2) 84 (21 .9) 94 (16.4) 25 -34 years 30 (15 .7) 1 83 ( 47. 9) 2 13 ( 37 .2) 35 -44 years 72 ( 37 .8) ... difference (66 .2) 2. 9 × 10 (50.0) 0 . 37 1 .2 × 10 0 .34 (75 .0)* 0.0 03 8 .7 × 1 02 0.09 2. 6 × 1 02 – – – – (34 .4) 1.8 × 1 02 – – – – 0 .22 0.19 – – – – 18 ( 62. 0) 2. 6 × 1 02 (16.6) 6 .2 × 1 03 25 (34 .2) 6.5 × 102...

Ngày tải lên: 12/08/2014, 01:21

... \u0000 \uFFFF - 128 1 27 25 5 - 32 76 8 32 76 7 65 535 -21 474 836 48 21 474 836 47 429 49 6 72 95 - 92 23 3 72 036 85 477 5808 92 23 3 72 036 85 477 58 07 1844 674 40 73 7 09551615 see text see text see text Table 4 .3: Default and ... Console.WriteLine("|{0:#.00}|{1:0.00}| {2, 5:0.00}| {3, -5:0.00}|", 23 , 23 , 23 , 23 ) ; } } Output: |$1. 23 | ($1. 23 ) | |1 23 | -01 23 | |1. 23 | 1. 23 0 0| |1. 23 0 000E+000|1. 23 | |1 23 . 00 %|1. 23 | |FF|000FF| FF|FF | |. 23 | 0. 23 | 0. 23 | 0. 23 | 3. 1.4 Declaring ... Class Reuse ■ reference is used to call back the Get method of Amount, retrieve its value, and return the discounted value (line 13) 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ...

Ngày tải lên: 12/08/2014, 09:22

... not have the concept of a checked or unchecked context, so all conversions are considered to be in a checked context—an unchecked context cannot be created in VB.NET An OverflowException will ... language can be done through the static methods on the Convert class The previous C# code can be converted to use the ToInt 32 method: // C# Code: finalValue = Convert.ToInt 32( (float) 13. 449); Console.WriteLine(finalValue.ToString( ... source = Int 32. MaxValue; destination = (short)source; } A checked context is when the conversion is contained in a checked block or if the / checked compiler option is set to true An example of code...

Ngày tải lên: 12/08/2014, 09:22

... variable of type int A long type can contain values as large as 9 ,2 23 , 3 72 , 036 ,854 ,77 5,808; however, the maximum size of an int is 2, 1 47, 4 83, 6 47 As such, that conversion could result in a loss of data—for ... exception of type System.OverflowException The syntax for a checked block uses the checked keyword, as shown in Listing 2. 22 Listing 2. 22: A Checked Block Example public class Program { public ... OUTPUT 2. 15: -21 474 836 48 Listing 2. 21 writes the value 21 474 836 48 to the console However, placing the code within a checked block, or using the checked option when running the compiler, will cause...

Ngày tải lên: 12/08/2014, 16:21