2 enhanced epidermal function of darkly pigmented skin correlates with a lower sc ph
Báo cáo y học: "Enhanced effector function of cytotoxic cells in the induced sputum of COPD patients" doc
Ngày tải lên :
12/08/2014, 11:22
... 173(10):6418-6426 21 Takahashi T, Chiba S, Nieda M, Azuma T, Ishihara S, Shibata Y, Juji T, Hirai H: Cutting edge: analysis of human V alpha 24+CD8+ NK T cells activated by alpha-galactosylceramide-pulsed ... Kobayashi A, Kooguchi K, Kitamura Y, Onodera H, Nakajima H: Upregulation of two death pathways of perforin/granzyme and FasL/Fas in septic acute respiratory distress syndrome Am J Respir Crit Care ... side scatter characteristics Cytotoxicity assay A commercially available lactate dehydrogenase (LDH) kit (CytoTox 96 Non-Radioactive Cytotoxicity Assay, Promega) was used with erythroleukaemic...
- 9
- 348
- 0
Báo cáo toán học: "Responses to elevated atmospheric CO concentration 2 and nitrogen supply of Quercus ilex L. seedlings from a coppice stand growing at a natural CO 2 spring" pot
Ngày tải lên :
08/08/2014, 14:21
... calculated as the ratio of total leaf area to total plant dry mass; specific leaf area, SLA (m g as the ratio of -1 ), total leaf area to leaf dry mass; partitioning of total plant ), -1 dry mass, ... September all plants were harvested and were separated into leaves, all the stem, and coarse (> mm) and fine (< mm) roots Surface area of each leaf and total foliage area of each seedling were measured ... averaged per plant, and plants measured with respect to each CO x N treat2 ment combination were averaged across the open-top chambers Statistical analyses consisted of two-way of variance (ANOVA)...
- 13
- 205
- 0
Báo cáo khoa học: "Lack of Cetuximab induced skin toxicity in a previously irradiated field: case report and review of the literature" pdf
Ngày tải lên :
09/08/2014, 08:23
... been irradiated for SCC and present a brief review of the literature Case Report A 78-year-old Caucasian male was diagnosed with a well differentiated squamous cell carcinoma (SCC) of the skin over ... erythema and dry skin remain in areas previously dominated by the papulopustular eruption [9] Here, we report a case of lack of Cetuximab-induced skin rash in an area that had previously been irradiated ... possibility that the therapy may not be as beneficial in the absence of a skin reaction Our patient had a recurrence in a previously irradiated area where skin sparing was noted during his re-irradiation...
- 4
- 251
- 0
Báo cáo khoa học: PA700, the regulatory complex of the 26S proteasome, interferes with a-synuclein assembly pptx
Ngày tải lên :
16/03/2014, 22:20
... triphasic, with an inital lag phase, followed by an exponential growth phase and ending with a steady state phase [4] Figure 1A and C illustrate that a decrease in protein concentration is accompanied ... protein aggregation and ⁄ or dysfunction of the ubiquitin ⁄ proteasomal system play a role in the development of familial PD Aberrant aggregation of proteins is one of many signals that activates ... EDTA, mm 2-mercaptoethanol) and increasing concentrations of PA700 as indicated A total volume of 100 lL was aliquotted per well of a 96-well plate containing a Teflon sphere in each well The samples...
- 11
- 398
- 0
Báo cáo khoa học: Probing plasma clearance of the thrombin–antithrombin complex with a monoclonal antibody against the putative serpin–enzyme complex receptor-binding site docx
Ngày tải lên :
17/03/2014, 10:20
... stoichiometry of binding In vivo clearance of the T–AT complex in rats Thrombin, native AT, and elastase-cleaved AT were labeled with 125I (Amersham Pharmacia AB, Uppsala, Sweden) using the chloramine ... to AT A very weak band above the bands of native AT in lanes and is probably a small amount of cleaved AT, which is an impurity of our native AT The bands correspond to the mobility of the cleaved ... where only two determinations were made Analyte/ligand AT native/IgG AT native/Fab AT latent/IgG AT latent/Fab AT cleaved/IgG AT cleaved/Fab T–AT complex/IgG T–AT complex/Fab ka (M)1Æs)1) 3.85 4.64...
- 11
- 378
- 0
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf
Ngày tải lên :
30/03/2014, 09:20
... Gehrmann J, Loughnan ML, Thomas L, Adams DA, Atkins A, Palant E, Craik DJ, Adams DJ, 2602 Alewood PF et al (2001) Two new classes of conopeptides inhibit the alpha1-adrenoceptor and noradrenaline ... thousand random structures were generated by dyana (v 1.5) that fit the primary sequence and covalent and spatial requirements of mr3e A total of 190 distance constraints, six u angle restraints and ... constraints were input for the molecular modeling protocol for the dyana algorithm The outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0.16 A and a ˚ mean global heavy atom...
- 7
- 346
- 0
Báo cáo hóa học: " High expression of transcriptional coactivator p300 correlates with aggressive features and poor prognosis of hepatocellular carcinoma" doc
Ngày tải lên :
18/06/2014, 16:20
... 0.002, Table 1) Discussion Transcriptional coactivator p300 has the potential to participate in a variety of cellular functions, such as cell proliferation and differentiation, senescence and apoptosis ... univariate and multivariate analysis In addition, stratified survival analysis of HCC accordingly to clinical stage evaluated p300 expression to be closely correlated with survival of HCC patients ... Ishihama K, Yamakawa M, Semba S, Takeda H, Kawata S, Kimura S, Kimura W: Expression of HDAC1 and CBP/p300 in human colorectal carcinomas J Clin Pathol 2007, 60:1205-1210 22 Karamouzis MV, Konstantinopoulos...
- 11
- 425
- 0
Báo cáo hóa học: " Some fixed point-type results for a class of extended cyclic self-mappings with a more general contractive condition" pdf
Ngày tải lên :
20/06/2014, 22:20
... Harjani, J, Lopez, B, Sadarangani, K: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space Abstr Appl Anal 2010, (2010) (Article ... 0 a (1 − α1 ) > − α1 and ® A ∪ A with >a ≥ 0, β1 = a0 a ≥ a1 ≥ a − A1 ∪ A2 a β1 = > It is noted that the condition (3.1) is not guarana0 − α1 teed to be contractive for any point of A1 It is also ... order of its elements □ An example is given below Example 3.6: Take p = and subsets A1 ≡ C (a, 0, a- a0) and A2 ≡ C( -a, 0, a- a0) of R2 are circles of centre in (a, 0) and ( -a, 0), respectively, and...
- 14
- 418
- 0
Báo cáo toán học: " ON THE NUMBER OF FULLY PACKED LOOP CONFIGURATIONS WITH A FIXED" pot
Ngày tải lên :
07/08/2014, 08:22
... polynomial in m In fact, the complete statement is even more precise It makes use of the fact that to any matching X one can associate a Ferrers diagram λ(X) in a natural way (see Section 2.4 for a ... interior of Qn which makes ABK into a rectangular isosceles triangle, with the right angle at K, we let M be the analogous point which makes F GM into a rectangular isosceles triangle, with the ... of unit horizontal and vertical steps in the positive direction Given two points A and E in Z2 , we write P (A → E) for the number of paths starting at A and ending at E We say that a family of...
- 43
- 272
- 0
Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx
Ngày tải lên :
07/08/2014, 15:22
... came from M1 and which from M2 The permanent of the adjacency matrix A of G also counts the number of spanning 2-regular subgraphs H of G, where now we allow odd cycles and cycles of length as ... every block is an all-1 square matrix, and as our graph G has no loops, this means that it is a union of complete balanced bipartite graphs, completing the proof References [1] L.M Bregman, Some properties ... all-1 matrix Proof of Theorem 1.1: The square of the number of perfect matchings of G counts ordered pairs of such matchings We claim that this is the number of spanning 2-regular subgraphs H of...
- 2
- 367
- 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf
Ngày tải lên :
07/08/2014, 20:24
... Gene amplified size (bp) 1,701 1,795 1,719 1,779 Primer sequence 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG ... H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge ... herpesvirus of turkeys vaccine expressing Newcastle disease virus fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida...
- 8
- 315
- 0
Báo cáo y học: "nhibition of established collagen-induced arthritis with a tumour α necrosis factor-α inhibitor expressed from a self-contained doxycycline regulated plasmid" pptx
Ngày tải lên :
09/08/2014, 01:23
... Treatment was administered after onset of clinical arthritis All treated animals are illustrated in panels a and b; those with a clinical score of or less at the time of DNA injection (day 27) are ... expression and increase the magnitude of regulation, as was recently achieved with an adenoviral vector [28] According to data obtained in clinical trials, transfection of human skeletal muscle with ... Naùve or arthritic DBA/1 mice were injected intraperitoneally with the muscle relaxant Hypnorm (Janssen Animal Health, Janssen Pharmaceuticals, Beerse, Belgium) and were anaesthetized with halothane...
- 11
- 464
- 0
Báo cáo y học: "Rituximab therapy reduces activated B cells in both the peripheral blood and bone marrow of patients with rheumatoid arthritis: depletion of memory B cells correlates with clinical response" potx
Ngày tải lên :
09/08/2014, 14:22
... 44:176-182 31 Tokunaga M, Saito K, Kawabata D, Imura Y, Fujii T, Nakayamada S, Tsujimura S, Nawata M, Iwata S, Azuma T, Mimori T, Tanaka Y: Efficacy of rituximab (anti-CD20) for refractory systemic ... the manuscript PS participated in the design of the study, performed the statistical analysis of the data and drafted the manuscript GB performed the statistical analysis of the data and drafted ... (Marseille, France), and anti-HLA-DR, anti-CD4, anti-CD3 antibodies were purchased from eBioscience (San Diego, CA, USA) Materials and methods Statistical analysis The Statistical Package for Social Sciences...
- 8
- 376
- 0
báo cáo khoa học: "Reduced expression of SMAD4 in gliomas correlates with progression and survival of patients" ppt
Ngày tải lên :
10/08/2014, 10:21
... pancreatic carcinoma, esophageal carcinoma, colorectal carcinoma, renal cell carcinoma, as well as breast carcinoma [17-20] Our results confirm that SMAD4 is He et al Journal of Experimental & Clinical ... SMAD4 expression and survival rates of patients Our data indicated that nearly 55% of glioma cases showed positive staining for SMAD4 The survival rate of patients without SMAD4 staining was lower ... used to amplify 332-bp transcripts of SMAD4 and the primers 5’- GGT GGC TTT TAG GAT GGC AAG -3’ and 5’- ACT GGA ACG GTG AAG GTG ACA G -3’ were used to amplify 161bp transcripts of b-actin All primers...
- 7
- 286
- 0
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
Ngày tải lên :
11/08/2014, 12:21
... Cancer, Ovarian Cancer and Leukemia SPOREs, and by a 2009 Seena Magowitz Pancreatic Cancer Action Network AACR Pilot Grant Author details RNA interference and non-coding RNA Center and the Department ... information GAC received his MD and PhD at Carol Davila University of Medicine in Bucharest, Romania After working on cytogenetics as an undergraduate student with Dragos Stefanescu in Bucharest, ... South Korea with an MD and PhD and is an assistant professor in the Department of Gastroenterology, Severance Hospital, Seoul His primary clinical focus is treating colon and gastric cancers The...
- 3
- 239
- 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot
Ngày tải lên :
11/08/2014, 15:22
... using an internationally validated instrument, based on a conceptual framework, and we analyzed our data in such a way as to make QOL data clinically relevant as a population health measure We needed ... data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education Headquarters counseling unit staff) Joy Wilson for data entry We are most grateful to the school ... model of Jirojanakul et al [13], the results of the regression analyses showed that variables from the personal factors (age and sex), parental factors (parental marital status and father’s occupation),...
- 12
- 500
- 0
Báo cáo khoa học: "Sequence diversity on four ORFs of citrus tristeza virus correlates with pathogenicity" ppsx
Ngày tải lên :
12/08/2014, 04:21
... 5'GTGCCACTCGGAAAACTGAAAT3' P349- Cc 5'TGAGCAGATCGGAGGTCTTG3' 5'ACGTCATCGTCCAAATCCA3' CP 5'ATGGACGACGAAACAAAGAAATTG3' 5'GC P13 P23 TCAACGTGTGTTAA3' 5'GACTTAGACACGAAGTGACC3' 5'CTAAAGTAAGCTCGCATATTG3' ... 1999), a seedling-yellows-inducing isolate NUagA from Japan (Suastika et al., 2001) and two mild isolates, T385 from Spain (Vives et al., 1999) and T30 from Florida-USA (Albiach-Martí et al., 2000) ... recent arrival of the aphid T citricida to Mexico, the most important vector of CTV, and the predominance of sour orange as a rootstock in almost all the country, this fact should be of great concern...
- 10
- 232
- 0
Báo cáo y học: " Characterization of probiotic Escherichia coli isolates with a novel pan-genome microarray" doc
Ngày tải lên :
14/08/2014, 08:20
... edited and approved the final manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is a table providing a ranked ... channel log2 intensity analysis approach offers an acceptable performance compared to the comparative dual channel approach, at a limited risk of increased false negatives but with the added advantage ... control strain Additional data file contains a detailed description of the microarray design Detailed not in Annotated data file Click here dateach strains description of in strain strainsthe for...
- 16
- 313
- 0
Báo cáo y học: "Normalization of boutique two-color microarrays with a high proportion of differentially expressed probes" ppt
Ngày tải lên :
14/08/2014, 17:22
... throughput assay to systematically interrogate genes of maximal interest at low cost [6,7] Boutique arrays are almost always two-color cDNA arrays because cDNA arrays are the easiest to customize and ... Boutique arrays are custom-made arrays that may contain only a few score genes With such small arrays it is easy to step beyond the tolerance of lowess normalization, particularly as genes are often ... issue of normalizing microarrays with a small number of biased probes, it is limited to comparing a pair of RNA sources that are known in advance It is not available for differential expression arrays...
- 8
- 166
- 0
the syntactic and lexical features of english and vietnamese newspaper headlines a contrastive analysis = phân tích đối chiếu các đặc điểm cú pháp và từ vựng của các tiêu đề bài báo tiếng anh và tiếng việt
Ngày tải lên :
28/02/2015, 11:54
... non-sentential headlines in the corpora, phrases appear as typical of headline language The phrasal headlines found were comparatively equal in both English and Vietnamese samples in which nominal ones ... Media Texts - Past and Present Language and Textual Structure Philadelphia PA: John Benjamins 31 Van Dijk, T A 1986 News Schemata New York: Dans Cooper and Greenbaum 32 Van Dijk, T A 1988 News as ... sentential and non-sentential headlines Sentential headlines Sentential headlines are all headlines that have a regular sentence structure, i.e all headlines with a subject and a finite verb phrase...
- 58
- 1.8K
- 22