2 allergen specific t cell recirculation options for in vitro testing
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
Ngày tải lên :
08/08/2014, 21:20
... important finding of the study is the similarity in allergen -specific Th cell quantity when analyzed at different time-points This suggests that the interassay variability is low and that the ... due to the inadequate power to detect a difference (data not shown) Specificity of allergen -specific activation of Th cells was demonstrated by showing that allergen -specific Th cells for all three ... specific Th cells) The percentage of the CFSElow cells after the day culture is referred to as the “index” of the quantity of allergen -specific cells (in this example, Timothy -specific Th index) The...
- 12
- 334
- 0
Báo cáo y học: "Effect of anti-IgE therapy on food allergen specific T cell responses in eosinophil associated gastrointestinal disorders" pot
Ngày tải lên :
13/08/2014, 13:22
... limitation of this system is that it does not clearly differentiate between changes induced by IgE blocking in vivo vs those occurring in the in vitro culture system In contrast to our findings, Schroeder ... receptors, it has been postulated that anti-IgE therapy may have in vivo immunomodulatory activity on T cell responses [8] To test the hypothesis that anti-IgE therapy affects allergen specific T cell ... immunomodulatory effect on allergen specific T cell responses However, given the multiple T cell endpoints examined in this study, the lack of any data supporting T cell inhibition is striking, particularly...
- 8
- 266
- 0
Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx
Ngày tải lên :
11/08/2014, 10:23
... patients lacked pathogenspecific in vitro T- cell responses suggesting that the degree and quality of immune reconstitution following ART is inadequate to eliminate underlying opportunistic infections ... patients Patient CD4 T cell count before ART cells/µl CD4 T cell count at presentation of IRIS cells/µl Fold change in CD4 T cell counts from baseline to IRIS presentation CD4 T cell count after ... utilising the thymidine incorporation assay, we demonstrate the correlation between in vitro functional data and clinical evidence There were two important findings in this study Firstly, patients...
- 11
- 365
- 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
Ngày tải lên :
18/06/2014, 15:20
... prognostic information, contributing to the design of efficient antimelanoma vaccines Competing interests The authors declare that they have no competing interests Authors' contributions FS, and ... an important role of the TRB chain in fine-tuning TR affinity of Melan-A -specific T cells of melanoma patients and argues against the hypothesis that high affinity TRs against self-Ags, like Melan-A, ... clonotypes that we have analyzed strongly suggests that these TRBV segments are important for melanoma Ag recognition, with TRBV28 being preferentially involved in the interaction between TR and...
- 14
- 532
- 1
Báo cáo hóa học: " Impact of g-chain cytokines on EBV-specific T cell cultures" doc
Ngày tải lên :
18/06/2014, 16:20
... T cells supplied with IL-21 Finally, striking was the finding that IL-15 CD4 + T cells, despite a vigorous in vitro cytotoxic activity in short-term assay, did not exert any inhibitory potential ... assays Standard cytotoxicity tests were performed with T cell lines at 21 days of culture At this time point (third restimulation, see Figure 1), we could test all the cell lines obtained but IL-21 ... substantially at least for the CD4+ T cell subset, the only one that could be tested Evaluation of cytokine production Next, we investigated the production of cytokines by cultures in response to...
- 8
- 453
- 0
Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx
Ngày tải lên :
09/08/2014, 01:22
... administrated glucocorticoids with monocyte-targeted therapies rather than T- cell apoptosis-inducing therapies Competing interests The authors declare that they have no competing interests Authors' ... number not for citation purposes) Soluble factor(s) rather than cellular interaction are essential for the induction of the T- cell apoptosis-resistant phenotype To further investigate the mechanism ... but without direct contact with, monocytes rescues isolated T cells from glucocorticoid-induced apoptosis Coculturing of TTcells inin the presence of, but without direct contact with, monocytes...
- 9
- 304
- 0
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot
Ngày tải lên :
09/08/2014, 01:23
... model puts together new insights into CTLA-4 functions (bottom) (1) During suboptimal T cell activation, CTLA-4 sets the threshold for activation (2) Already activated T cells are inhibited in their ... apoptosisinducing molecules is activation dependent, CTLA-4 crosslinking during T cell activation prevents T cell activation rather than terminating AICD Thus, these unactivated or incompletely ... of CTLA-4 mRNA is detectable in naive T cells within hour after activation [10] After activation of the T cell, intracellular CTLA-4 protein increases steadily in concentration and is stored in...
- 10
- 393
- 0
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
Ngày tải lên :
09/08/2014, 13:22
... GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 TCCTCTCACTGTGACATCGGCCCA BV18 CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCTCACTGTGACATCGGCCCA BV20 TGCCCCAGAATCTCTCAGCCTCCA ... GGGTGTGGGAGATCCTGC BV1 CCGCACAACAGTTCCCTGACTTGC BV3 CGCTTCTCCCTGATTCTGGAGTCC BV4 TTCCCATCAGCCGCCCAAACCTAA BV5 GATCAAAACGAGAGGACAGC BV6A GATCCAATTTCAGGTCATACTG BV6B1 CAGGGCCAGAGTTTCTGAC BV6B2 CAGGGCTCAGAGGTTCTGAC ... TGCCCCAGAATCTCTCAGCCTCCA BV21 GGAGTAGACTCCACTCTCAAG BV22 ATTCTGAACTGAACATGAGCTCCT BV24 GACATCCGCTCACCAGGCCTG BJ1.1 TCTGGTGCCTTGTCCAAAGAAAGC BJ1.2 CCTGTCCCCGAACCGAAGGTGTA BJ1.3 CCAACTTCCCTCTCCAAAATATAT BJ1.4 CTGGGTTCCACTGCCAAAAAACAG...
- 18
- 340
- 0
Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf
Ngày tải lên :
09/08/2014, 13:22
... administrated glucocorticoids with monocyte-targeted therapies rather than T- cell apoptosis-inducing therapies Competing interests The authors declare that they have no competing interests Authors' ... number not for citation purposes) Soluble factor(s) rather than cellular interaction are essential for the induction of the T- cell apoptosis-resistant phenotype To further investigate the mechanism ... but without direct contact with, monocytes rescues isolated T cells from glucocorticoid-induced apoptosis Coculturing of TTcells inin the presence of, but without direct contact with, monocytes...
- 9
- 397
- 0
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt
Ngày tải lên :
11/08/2014, 10:23
... in HAART treated HIV-1-infected patients before and after rhGH immuProliferative CD4+ T- cell responses to HIV-1 antigens in HAART treated HIV-1-infected patients before and after rhGH immunotherapy ... Figure treated patients at baseline in response 12, 24 in HAART IFN-γ production by T cells and at weeksto PHA and 48 IFN-γ production by T cells in response to PHA in HAART treated patients at baseline ... rhGH treatment promotes the restoration of Tcell responses against HIV-1, a restoration that declines with cessation of treatment Since HIV-1+ patients commonly develop growth hormone abnormalities,...
- 13
- 359
- 0
Báo cáo y học: " Differences in allergen-induced T cell activation between allergic asthma and rhinitis: Role of CD28, ICOS and CTLA-4" potx
Ngày tải lên :
12/08/2014, 13:22
... therefore constitutive and independent of allergen presentation The constitutive Th1 activation in asthma was demonstrated before [10,12,21] It could result from the intrinsic defect in the CTLA-4+ ... decreased the Th2 cytokine production, indicating the involvement of CD28 in Th2 cell activation in allergy It is noteworthy that although significant statistically, the proportion of CD28+ cells ... subjects only if the unknown conditions leading to the constitutive Th1 activation are present Still missing in the puzzle is the stimulus inducing the Th2 activation present in non allergic asthma...
- 10
- 292
- 0
Báo cáo y học: "SIV antigen immunization induces transient antigen-specific T cell responses and selectively activates viral replication in draining lymph nodes in retroviral suppressed rhesus macaques" pptx
Ngày tải lên :
13/08/2014, 01:21
... that returned to undetectable weeks later, no increase in viral loads that could be attributed to SIV gag immunization induced viral replication was detected The data suggest that in the setting ... Forward: 5’- AGGCTAATACATCTTCTGCATCAAAC - 3’ Reverse: 5’- GGGTCCTGTTGGGTATGAGTCTA - 3’ Probe: 5’ - CCACCCTCTTATTTCC - 3’ SIV singly spliced Forward: 5’- AGAGGCCTCCGGTTGCA-3’ Reverse: 5’- CCTTCCCCTTTCCACAATAGC-3’ ... responses in draining LNs from the same animal at the same time, making it possible to study the effect of antigen stimulation in the context of ART-treated, chronic infection with limited animal...
- 11
- 287
- 0
Báo cáo y học: "Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling" pot
Ngày tải lên :
14/08/2014, 17:22
... cell survival or death, initiated by binding of the same receptor to its ligand, are controlled by quantitative differences in TCR affinity for self peptideMHC that are translated into qualitatively ... strongly in negative than positive selection Probesets in these categories are likely to include genes that report the quantitative differences in TCR signaling thought to differentiate strong TCR ... These data generate the hypothesis that the cytogenetic band 2F contains a concentration of apoptotic initiators for negative selection that may be coregulated by chromatin structure Global gene...
- 23
- 221
- 0
Báo cáo hóa học: " Comparison of T-cell receptor repertoire restriction in blood and tumor tissue of colorectal cancer patients" docx
Ngày tải lên :
18/06/2014, 16:20
... other tumor entities, which have been interpreted as indication for the induction of specific clones reactive to autologous tumor [26,42] In fact, this TCR repertoire restriction in tumor patients ... compared to corresponding tissue of unaffected colon Infiltration of CTLs in colon carcinoma tissue had been identified as prognostic factor suggesting TAA associated CTL activation [12] Interestingly, ... participated in the conduct of the study ET participated in design and conduct of the study UK participated in design and conduct of the study DN conceived of the study, coordinated the study and drafted...
- 9
- 416
- 0
Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx
Ngày tải lên :
10/08/2014, 23:21
... double positivity for CD8 and CD4; in one case phenotype was not interpretable and in three cases it was not reported TCRa presented with clonal rearrangements in nine out of 10 patients and EBV ... reported in eastern Asia [5], specifically in Japan and Taiwan The geographical distribution has been suggested to indicate possible genetically determined defects in T cell responses to EBV in ... childhood in the World Health Organization classification of tumors of hematopoietic and lymphoid tissues [5] This entity is a rare clonal proliferation of EBV-infected T cells with an activated cytotoxic...
- 5
- 379
- 0
Báo cáo y học: " T-cell activation promotes tumorigenesis in inflammation-associated cancer" potx
Ngày tải lên :
12/08/2014, 23:22
... reporter for tumor associated inflammation [27] The third transgene is a genetic manipulation of the T- cell receptor that restricts its recognition to ovalbumin such that activation of T- cells in ... bioluminescence in TAX-LUC mice after treatment with poly(I:C) and LPS was more evident in the spleen and gastrointestinal tract than liver Taken together, these studies indicated that bioluminescence ... demonstrated that wounding, T- cell activation, and exposure to chemical agents exacerbated development of lymphoma Competing interests The authors declare that they have no competing interests Authors'...
- 10
- 217
- 0
Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa
Ngày tải lên :
13/08/2014, 09:21
... carried out as in two stages using the following primers: stage 1, upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; ... C-3'; for stage 2, downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' The 141 bp U3 region was removed from the plasmid ... correlates with the level of vector RNA packaged indicating that this is a major determinant of vector efficiency It suggests that there are as yet unidentified differences in the RNA capture mechanisms...
- 14
- 437
- 0
Báo cáo sinh học: " Establishment of stable Huh-7 cell lines expressing various hepatitis C virus genotype 3a protein: an in-vitro testing system for novel anti-HCV drugs" potx
Ngày tải lên :
14/08/2014, 19:22
... proteins: core; envelope protein (E1) and E2 are structural proteins that constitute the virion; a small protein that is essential for protein assembly [10,11,14] and six non structural proteins ... infection globally is striking with an urgent necessity to have better information of viral pathogenesis in order to develop new anti-HCV strategies To test novel drugs for its inhibitory action, ... generated using genotype 1b HCV RNA, the present replicon system may not be used to detect responses that are genotype and subtype-dependent Therefore this study was initiated to establish stable cell...
- 6
- 321
- 0
Development of human stem cell based model for developmental toxicity testing
Ngày tải lên :
09/09/2015, 08:18
... nonrodents compared with all in vitro developmental toxicity testing platforms are quite easy to interpret First, it can test the adverse effects of compounds throughout the whole cycle of offspring ... development observed in the presence of maternal toxicity, it’s difficult to rule out the possibility that the abnormality is due to indirect maternal toxicity instead of developmental toxicity of the ... relevant studies Background and Significance This chapter introduces the background information of the studies presented in this dissertation In order to detect the developmental toxicity potential...
- 165
- 239
- 0
Pnipaam modified PCL matrix for in vitro cell culture study
Ngày tải lên :
28/11/2015, 13:53
... PCL/2,2-bis(2oxazoline) Techniques Vitro/ Vivo Researchers In vitro In vitro Pitt et al.42; Buntner et al.43,44 Martini et al.45 Guerra et al.46 both Limin et al.47 In vitro Barbato et al.48 In vitro Cha and Pitt49 ... solvent evaporation In vitro Indomethacin PCL melt-dispersion In vitro Nitrofurantoin Insulin PCL PCL solvent evaporation solvent evaporation In vitro In vitro Gadzinowski et al.34 Cao and Shoichet35 ... with data obtained mostly from in vitro tests Clinical trials had proven its applications for the internal fixation of bones, while fixation methods and designs remained two of the most important...
- 68
- 389
- 0