2 saving application state for a single session
Báo cáo y học: "Effectiveness of a single-session early psychological intervention for children after road traffic accidents: a randomised controlled trial" pot
Ngày tải lên :
13/08/2014, 18:21
... time, two factorial analyses of variance (ANOVAs) with repeated measures design were calculated A series of additional analyses of covariance (ANCOVAs) were conducted entering age, sex and severity ... approach for dealing with traumatic symptoms in an early stage after an RTA Young children can profit from a single- session early intervention around 10 days after an RTA We suggest involving at least ... our findings suggest an ageand development-specific approach for dealing with traumatic symptoms in an early stage after a road traffic accident Also, the intervention evaluated here needs to be...
- 10
- 268
- 0
Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx
Ngày tải lên :
12/08/2014, 14:22
... and inflammatory events [5] Pre-eclampsia is associated with circulating autoantibodies against the AT1 protein that act as functional receptor agonists to promote vasoconstriction and inflammation ... to alter the balance of the renin–angiotensin system to favor the ACE2– Ang-(1–7)–AT7 receptor axis and promote the antifibrotic and anti-inflammatory actions of the heptapeptide, as well as attenuate ... importance in our understanding of the role of circulating and tissue sources of ACE2, particularly in various disease states Increased circulating levels of ACE2 may reflect a compensatory mechanism...
- 2
- 364
- 0
application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface
Ngày tải lên :
13/11/2014, 08:18
... Chiyokura and Kimura (1984) As a result, boundary interpolating patch has several drawbacks for modification a large number of small surfaces that are bonded together to create a larger surface 2.2 ... the GA has been used as a major tool to search for optimal boundary curves and to fit a surface A preliminary hull surface is assumed to be a gene type The encoded design variables for surface ... from rectangular patches and triangular patches A flexible CAD system should perform a good quality of shape and an interactive manipulation The B-spline vertex point modification actually works...
- 113
- 521
- 1
Figures 2 to 5 Single-cavity mold for a snap ring
Ngày tải lên :
29/04/2016, 13:51
... of the narrow ends, there is a tapered surface extending inward from the rim at an angled of 45“ The adjacent rib has a similarly angled surface that a single slide (l), to which two detail inserts ... 280 mm The cavities are oriented in such a manner The mold is filled via a sprue bushing that feeds a short runner leading to a narrow edge gate located midway along each part Part Release/Ej ection ... surfaces as the mold fills LSR has an extremely low 300 Examples ~ Example 113/Example 114 viscosity and penetrates gaps smaller than 0.01 mm, so that care must be taken when machining partforming...
- 24
- 633
- 0
Tài liệu Use a Single Windows Form to Update Multiple Lookup Tables Just about every database application pptx
Ngày tải lên :
14/12/2013, 20:16
... Select command for the modaLookupData data adapter The data table called dtData is then filled and set as the data source for dgTableData Listing 8.10 frmHowTo8_2.vb: Populating the DataGrid Control ... Update the data adapter and data table to reflect the new data, ' and reassign the data source of the data grid modaLookupData = New OleDb.OleDbDataAdapter("Select * From " & Me.lstLookupTables.Text, ... the data grid ' saves a bunch of hassles trying to track the data table directly dtFromGrid = CType(dgTableData.DataSource, DataTable) ' Commands necessary to actually post back to server modaLookupData.Update(dtFromGrid)...
- 6
- 356
- 0
Tài liệu Maintaining State in a Web Application pptx
Ngày tải lên :
24/12/2013, 01:17
... building a Web site that a user can order products from, store their shopping cart in the database Using a DataGrid Control to Access a Database A DataGrid allows you to access rows in a database table ... information about a Web application in the database Storing Information Using a Session Object A Session object allows you to store separate information for each user The information stored in the Session ... The Application object allows you to store information that is shared for all users One use for the Application object might be to store a DataSet object containing a product catalog The information...
- 22
- 412
- 0
PHÂN TÍCH báo cáo NGHIÊN cứu state owned enterprises (SOEs) in vietnam perceptions of strategic direction for a society in transition
Ngày tải lên :
24/12/2013, 23:11
... ngh a Trong khuôn khổ môn học Phương pháp nghiên cứu khoa học, nhóm phân công phân tích báo cáo nghiên cứu có đề tài "State- owned enterprises (SOEs) in Vietnam - Strategic direction for a society ... tài: State- owned enterprises (SOEs) in Vietnam Perceptions strategic direction for a society in transition” Tạm dịch: Nhóm - Lớp Đêm - K22 Tiểu luận môn PPNCKH GVHD: TS Đinh Thái Hoàng date]TiTi6 ... lãnh đạo vấn, ý định cấu lại doanh nghiệp họ kinh tế cạnh tranh toàn cầu kinh tế Việt Nam ch a hoàn toàn mở c a để doanh nghiệp cạnh tranh cách tự do, bình đảng Thứ hai, tác giả tiếp tục phân tích...
- 18
- 676
- 2
iec 60332-2 tests on electric cables under fire conditions - test on a single small vertical insu
Ngày tải lên :
25/12/2013, 10:59
... gas-pressure cables and their accessories 141-1 (1976) Part : Oil-filled, paper-insulated, metal-sheathed cables and accessories for alternating voltages up to and including 400 kV Part 2: Internal gas-pressure ... measure 600 f 25 mm Two such samples shall be available, designated and Conditioning before t e s t If t h e insulated w i r e has a paint o r lacquer f i n i s h t h e samples shall b e maintained ... Determination of the amount of halogen acid gas evolved during the combustion of polymeric materials taken from cables Heating cables with a rated voltage of 300/500 V for comfort heating and prevention...
- 13
- 402
- 1
Tài liệu Lab 2.2.4 Establishing a Console Session with HyperTerminal doc
Ngày tải lên :
18/01/2014, 04:20
... Step Start HyperTerminal program a Turn on the computer and router b From the Widows taskbar, locate the HyperTerminal program: Start > Programs > Accessories > Communications > Hyper Terminal Step ... Step Name the HyperTerminal Session a At the “Connection Description” popup, enter a name in the connection Name: field and select OK Step Specify the computers connecting interface a At the ... procedure for establishing a console session with the router Step Closing the session a To end the console session from a HyperTerminal session, select: File > Exit b When the HyperTerminal disconnect...
- 4
- 425
- 0
Tài liệu Lab 2.2.4 Establishing a Console Session with HyperTerminal ppt
Ngày tải lên :
18/01/2014, 04:20
... Step Name the HyperTerminal Session a At the “Connection Description” popup, enter a name in the connection Name: field and select OK Step Specify the computers connecting interface a At the ... procedure for establishing a console session with the router Step Closing the session a To end the console session from a HyperTerminal session, select: File > Exit b When the HyperTerminal disconnect ... HyperTerminal connection, as shown in Step a At the “Connection Description” popup, select Cancel b To open the saved console session from HyperTerminal, select: File > Open The saved session will now appear...
- 4
- 460
- 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf
Ngày tải lên :
19/02/2014, 05:20
... experimentally, as we used P1,P5-di(adenosine-5¢)-pentaphosphate (Ap 5A) as inhibitor of adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady -state respiration Instead, ... (Supplementary material, Table S2) and steady -state fluxes (Table and [16] for glutamate plus malate and succinate, respectively) Values are mean ± SEM from three (succinate) or four (glutamate plus malate) ... the ATPtotal ⁄ ADPtotal ratio reflect changes in the ATPout ⁄ ADPout ratio Palmitoyl-CoA caused a significant concentration-dependent decrease in the ATPtotal ⁄ ADPtotal ratio and increase in [AMP]total,...
- 15
- 546
- 0
Application for a Business (Short Stay) visa (for a stay of up to 3 months) doc
Ngày tải lên :
15/03/2014, 20:20
... in Australia to speak to an operator (recorded information available outside these hours) If you are outside Australia, please contact your nearest Australian mission Please keep these information ... eligibility for grant of the visa I have applied for, and for law enforcement purposes DAY MONTH YEAR Part I – Payment details 40 How will you pay your application charge? If applying in Australia, debit ... of America, Canada and New Zealand These international information exchanges may involve the sharing of personal identifiers, including facial images and fingerprint data, collected by immigration...
- 11
- 624
- 0
Application for a Subclass 457 – Temporary Work (Skilled) visa pot
Ngày tải lên :
15/03/2014, 20:20
... www.immi.gov.au/skilled If you are applying for a visa in Australia this form also serves as an application for any class of bridging visa (classes A, C or E) for which you may be able to apply A bridging ... visa application before your current visa expires Note: If you already have a visa for travel to Australia and you are granted another visa, the first visa will cease Step Complete the application ... the MARA website www.mara.gov.au You can also access information about migration agents on the department’s website www.immi.gov.au Visa Application Charge Payment must accompany your application...
- 18
- 401
- 0
Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf
Ngày tải lên :
16/03/2014, 12:20
... AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ATL14L15F18 (5¢-AAATCCGATGCAATCCTGGACCTGCTG AAGGAATTTCTTTCCACCGACGCC-3¢) For construction ... palmitic acid to the sample The values are mean ± SD from at least four different analyses Plant Type Ergosterol Palmitic Acid E lagascae E lagascae E lagascae E lagascae A thaliana A thaliana ... mutagenesis of A thaliana and E lagascae SCP-2 The following oligonucleotides were used for in vitro mutagenesis: ELM13M14 (5¢-AAGTCCCAAAATATTATGGA TATGATGGCTCGATTTCTCGAG-3¢); ELE28 (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢);...
- 15
- 391
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
Ngày tải lên :
22/03/2014, 11:20
... Source: [52] a Canadian figures for 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from ... changes in childcare in the 1990s have involved decreasing affordability of childcare for Canadian families, decreasing availability of affordable spaces for working families, reductions in quality ... Regulated childcare spaces are available for only 10% of Canadian children 0–12 Canada—in despite of repeated political commitments to such a program—has no national childcare program in contrast...
- 17
- 843
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
Ngày tải lên :
23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo khoa học: "A Comparison of Head Transducers and Transfer for a Limited Domain Translation Application" pptx
Ngày tải lên :
24/03/2014, 03:21
... of a word and acceptor to start an entire derivation Monolingual Relational Models We can characterize the language models used for analysis and generation in the transfer system as quantitative ... Probabilistic Model of Link Grammar" In Proceedings of the 1992 AAAI Fall Symposium on Probabilistic Approaches to Natural Language, 89-97 References Alshawi, H and A. L Buchsbaum 1997 "StateTransition ... particular type of finite state a u t o m a t a associated with each word in the language A relational head acceptor writes (or accepts) a pair of symbol sequences, a left sequence and a right sequence...
- 6
- 324
- 0
An Object-Oriented Multimedia Database System for a News-on-Demand Application* pot
Ngày tải lên :
30/03/2014, 22:20
... relational database This model forms a basis for a hierarchical data model and for temporal access control algorithms to allow VCR-like capabilities They show how it can be mapped to a relational ... object-oriented database in later stages of this research This will enable us to take advantage of advanced features like temporal models that are fundamental for multimedia applications It is hoped that one ... media, and (Gibbs et al 1993) deals with so-called audio/video (AV) databases These databases are collections of digital audio/video data and processes which can 37 compose and aggregate these data...
- 45
- 252
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
Ngày tải lên :
31/03/2014, 08:20
... green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite ... substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and (i.e domain B) from AMY2 ... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a- Amylase Barley...
- 14
- 557
- 0