2  retrieving a reference to an address book

Tài liệu Converting a DataSet to an ADO Recordset docx

Tài liệu Converting a DataSet to an ADO Recordset docx

... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored...

Ngày tải lên: 14/12/2013, 18:16

15 390 0
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names ... = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected...

Ngày tải lên: 26/01/2014, 10:20

5 310 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
a means to an end the biological basis of aging and death apr 1999

a means to an end the biological basis of aging and death apr 1999

... maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and stroke, cancer and pneumonia account for three-quarters of all human deaths ... AND LIFESPAN Table 1.2 Maximum Possible Lifespans for Selected Species Common Name Marine bivalve (Giant) tortoise Human Maximum Lifespan (Years) 220 180 122 Elephant 70 Halibut 60 Orangutan ... understandable, and certainly greatly appreciated But maximum possible lifespan is a mystery that continues to fascinate us T h e causes of human death have changed dramatically during our history as a...

Ngày tải lên: 11/06/2014, 05:26

246 670 0
Describe a visit to an interesting exhibition ppt

Describe a visit to an interesting exhibition ppt

... radiant with joy On the walls, different patterns of modern paintings were hung: charcoal drawings, pencil drawings and oil paintings were on display Most of them reflect daily activities and ... into a world of imagination and dreams As I strolled through the exhibition halls, I heard the voices of lecturers who were telling the visitors about the artists and their works An oil painting ... brought me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings to keep as souvenirs...

Ngày tải lên: 22/07/2014, 04:20

5 503 0
báo cáo khoa học: "Acceptance of shared decision making with reference to an electronic library of decision aids (arriba-lib) and its association to decision making in patients: an evaluation study" potx

báo cáo khoa học: "Acceptance of shared decision making with reference to an electronic library of decision aids (arriba-lib) and its association to decision making in patients: an evaluation study" potx

... for data analysis, carried out the study, performed the statistical analyses, and drafted the manuscript HK participated in the study design and coordination, the rationale for the data analyses, ... manuscript NDB participated in the study design and coordination, the rationale for the data analyses, and helped to draft the manuscript All authors read and approved the final manuscript Competing ... analyses, carried out the study, Page of and helped to draft the manuscript TK participated in the study design and coordination, the rationale for the data analyses and helped to draft the manuscript...

Ngày tải lên: 10/08/2014, 11:20

9 407 0
Giáo án Tiếng Anh lớp 10: UNIT 3: A TRIP TO THE COUNTRYSIDE Lesson 2: Speaking + Language Focus potx

Giáo án Tiếng Anh lớp 10: UNIT 3: A TRIP TO THE COUNTRYSIDE Lesson 2: Speaking + Language Focus potx

... exchange: S1: Is there a banyan tree in the village? S2: Yes There is a banyan tree at the entrance to the village 3.Pairwork: - Ask students work in pairs again, ask and answer about their partner’s ... minutes to get there The people in my home village plant rice and raise cattle for their living If you go to the village you can see a big banyan tree at the entrance to the village Although ... village (Based on the dialogue and the game above) - Teacher monitors and helps weak students - Give feedback and correct III Post–speaking:(Writeitup) - Get students to write a short paragraph...

Ngày tải lên: 08/08/2014, 14:22

7 2,3K 0
ĐỒ ÁN XE CHỞ HÀNG bám LINE MOBILE platform to track a reference line

ĐỒ ÁN XE CHỞ HÀNG bám LINE MOBILE platform to track a reference line

... nghệ cao phức tạp so với loại AGV khác  Loại chạy theo đường dẫn (Fixed path navigation) :Xe AGV thuộc loại thiết kế chạy theo các đường dẫn định sẵn gồm loại đường dẫn sau: - ... robot là nhu cầu tất yếu Vì để dễ dàng quản lý, các AGV sẽ cấu hình theo kiểu Wireless Access Point b Aim iBot AGV cu a AIM IBOT có cấu xe bánh: bánh chủ động ph a sau và một bánh ... sai ±20 mm Ph a trước xe có lắp Laser để quét các trở ngại và vị trí nhận hang, trả hang Cảm biến có thể a t đến độ xác dừng ±20 mm Xác định đầu Ở nước ta nay, công nghệ chế tạo...

Ngày tải lên: 04/01/2016, 20:22

54 1,5K 5
Thiết kế hai phương án tuyến đường ô tô đi qua 2 điểm A-B thuộc địa phận xã Đăk Nhau huyện Bù Đăng tỉnh Bình Phước

Thiết kế hai phương án tuyến đường ô tô đi qua 2 điểm A-B thuộc địa phận xã Đăk Nhau huyện Bù Đăng tỉnh Bình Phước

... sau: Quay phần đường ph a lưng đường cong quanh tim đường mặt cắt ngang có độ dốc ngang phần xe chạy, sau tiếp tục quay quanh tim đường tới lúc đạt độ dốc siêu cao LÊ VĂN THƯỜNG_TĐHTKCĐ48 Page ... p = 0.6 MPa Vậy Tax = 0.019p = 0.0192 × 0.6 = 0.0115 MPa Với H = 50, ϕ = 240 tra to n đồ ta Tav = - 0.0011 MPa Vậy Tax + Tav = 0.0115 -0.0011 = 0.0104 MPa Ta có trị số lực dính tính to n: Ctt ... NGANG ĐƯỜNG Bề rộng xe Bề rộng xe chạy xác định d a vào điều kiện sau: - D a vào vận tốc xe chạy V = 40 km/h - D a vào kích thước thùng xe khoảng cách hai trục bánh xe - D a vào khoảng cách an...

Ngày tải lên: 08/01/2016, 14:12

139 2,1K 5
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...

Ngày tải lên: 02/11/2012, 11:12

4 520 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...

Ngày tải lên: 06/11/2012, 10:35

2 526 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... Agreeing and disagreeing (AD); Stating a preference (PR); and Giving an explanation (EX) that learners can flexibly apply to their writing with each pattern of essay organization Sometimes, a combination ... familiar with Agreeing and Disagreeing, Giving an Explanation or Making an Argument Some thought that Cause and Affect pattern of essay organization should be paid more attention to TWE preparation It ... organizations of cause and effect essay: block and chain In block organization, all the causes are discussed as in a block and the all the results are mentioned in another block In chain organization,...

Ngày tải lên: 06/11/2012, 10:35

48 603 1
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis

... have to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily to ... parents are important teachers when children are small but they cannot be the best ones all the time There’s still a gap between children and parents in every family WRITING PAPER Name: Group A Paper: ... can learn the good things Moreover, through books they can learn from their teachers Many learners are directly influenced by their own teachers They might behave or have a dream that the teacher...

Ngày tải lên: 06/11/2012, 10:35

4 480 0
Unit 3 : A trip to the countryside. Part 1,2.

Unit 3 : A trip to the countryside. Part 1,2.

... + thời gian and thời gian From + thời gian to thời gian Now listen to Liz,s trip to Ba,s home village Practice: a) True or false, Check (x) the box , correct the false sentences 2.Many people ... 3.There is a small bamboo forest at the entrance to the village F 4.Liz had a snack at at the house of Ba,s uncle F 5.There is a shrine on the mountain near Ba,s village T 6.Everyone had a picnic ... They are + Ving Liz,s trip to Ba,s home village a Matching game: Chance (n): Travel (v) Bamboo forest (n) Entrance (n) River bank(n) Bờ sông Cổng vào Cơ hội Đi/Du ngoạn Rừng tre b Vocabulary 1.Banyan...

Ngày tải lên: 01/07/2013, 01:25

14 1K 4
đề gốc bai thi số 2 lớp 10 nc (đáp án A)

đề gốc bai thi số 2 lớp 10 nc (đáp án A)

... which has the same meaning with this one : We / plan / take / trip / Halong / next week A B C D We plan to take a trip to Halong next week We had planed to take a trip to Halong next week We have ... stress due to heavy work load We constantly under stress due to heavy work load We are constantly stress due heavy work load We are constantly under stress because to heavy work load Choose the ... specialized facilities to help the blind people learn There are many specialized equipment to help the blind learn There are many specialized facilities help the blind to learn There are many...

Ngày tải lên: 02/07/2013, 01:25

5 779 0
De du tru 2 Khoi A 2007 (co dap an)

De du tru 2 Khoi A 2007 (co dap an)

... AM ⊥ BC ⇒ SMA = ( SBC, ABC ) = 60 o Suy ∆SMA có cạnh o Do SSMA = SM.AM sin 60 = N a A 3a2 3a2 = 16 C 60° M B 1 3a2 a3 Ta có VSABC = 2VSBAM = .BM.SSAM = a = 16 16 Gọi N trung điểm đoạn SA Ta ... Ta có CN ⊥ SA ⇒ CN = a 13 (vì ∆SCN vuông N) 1 a a 13 a2 39 ⇒ SSCA = AS.CN = = 2 16 Ta có VSABC = a3 1 a2 39 = SSCA d ( B, SAC ) = d ( B, SAC ) 16 3 16 ⇒ d ( B,SAC ) = a 3 3a = a2 39 13 ... u Ta có VTCP đường thẳng AB (−2,4,0) hay a = (−1,2,0) uu r Ta có VTCP đường thẳng OC (2,4,6) hay b = (1,2,3) uuu r ur u Ta có OA = (2,0,0) phương với c = (1,0,0) rr r Ta có a, b  c = ≠ ⇔ AB...

Ngày tải lên: 20/08/2013, 12:10

8 937 4
w