2 displaying a consumer in the ebusiness center header

Telesales - Kĩ năng bán hàng qua điện thoại

Telesales - Kĩ năng bán hàng qua điện thoại

... Party Types Affect the Way You View and Enter Customer Information Displaying a Consumer in the eBusiness Center Header Displaying an Organization in the eBusiness Center Header Displaying ... in the eBusiness Center Displaying a Lead in the eBusiness Center Displaying a Lead in the Lead Center Creating a Lead in the Lead Center Entering Interests, ... Manufacturing xviii Oracle Order Management Suite APIs and Open Interfaces Manual This manual contains up-to-date information about integrating with other Oracle Manufacturing applications and...

Ngày tải lên: 13/01/2014, 14:14

256 10,3K 76
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan ... means that the removal of the L-arabinose residues from the galactomannan oligosaccharides is caused by traces of an enzyme in the b-1,4endogalactanase preparation that is not active against the ... characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was made in which galA was fused to the...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
The Importance of Eye Contact in the Classroom

The Importance of Eye Contact in the Classroom

... to make eye contact while they are working together in pairs or groups Start by training them to listen to each other using non-verbal responses only Research shows that there is a strong link ... Show praise, encouragement often, and disapproval occasionally Remind learners that they ought to know an answer or that they could provide a response if they tried Use eye contact as a correction ... between the amount of eye contact people receive and their degree of participation in group communication in the number of turns taken in a group conversation for example The NLP approach to...

Ngày tải lên: 06/09/2013, 10:10

2 699 0
Tài liệu Module 4: Displaying an XML Document Using XSL ppt

Tài liệu Module 4: Displaying an XML Document Using XSL ppt

... To introduce the lab Lead -in In this lab, you will create an XSL style sheet to transform XML data into an HTML table in the LitWare Books Web application Explain the lab objectives In this lab, ... example, consider two applications that require the same data but in a different format of XML In such a case, a conversion is required when passing that data from one application to the other ... Narayanaswamy (NIIT) Subject Matter Experts: Andy Olsen (QA Training), Andy Longshaw (Content Masters) Content Lead: Janet Robinson Graphic Artist: Scott Serna (Creative Assets) Media Management:...

Ngày tải lên: 09/12/2013, 17:15

60 467 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx

Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx

... that in no cases were sarin and cyclosarin measured, although a Czechoslovak chemical-decontamination unit did detect sarin in areas of northern Saudi Arabia within the timeframe of the Khamisiyah ... of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... (CIA-DOD 1997) Two other storage sites in central Iraq, Muhammadiyat and Al Muthanna, sustained damage from air attacks during the Gulf War Munitions containing 2.9 metric tons of sarin– cyclosarin...

Ngày tải lên: 16/02/2014, 01:20

292 575 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... to be invariable as all the enzymes analyzed so far have a a3b3 (F1F0) or A3 B3 (A1 A0, V1V0) stoichiometry [28] The uncertainty lay in the number of ion-translocating subunits in the membrane-embedded ... reference-free averages generated by translational and rotational alignment of single c rings showed the same stoichiometry (Fig 2D,E) From both the raw data and averages of c rings, it was clear that they ... SDS–PAGE, with an apparent molecular mass of 57–59 kDa, depending on the acrylamide concentration used (Fig 1A) Western blotting analyses of the intact as well as the denatured c rings revealed the...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

... domains in the crystal; the PYR domain has the lowest average B-factor, ˚ 23 A2 (comparable to the B-factor of bound ThDP), whereas the middle domain has the highest overall B-factor, ˚ 37 A2 ... simulation programme for displaying reciprocal-space diffraction data J Appl Crystallogr 32, 375–376 Navaza, J (1994) AMoRe: an automated package for molecular replacement Acta Crystallogr A5 0, ... contributing to these interfaces is located in the PYR and middle domains The interface contains 10 hydrogen bonds in IPDC The dimer–dimer interface in IPDC is smaller than the corresponding interface...

Ngày tải lên: 20/02/2014, 11:20

10 558 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... disruption cassette containing the apramycin resistance gene [aac(3)IV] and oriT was used as template The mutant was constructed using the oligonucleotides 5¢-acccc tctcggaccgtccccaccggaggacccccccatgATTCCGGGGATC ... DdesA mutant complementation A 4204-bp ScaI fragment containing the desA coding region was cloned into the pBluescript SK EcoRV site As the DdesA mutant is apramycin resistant, the kanamycin resistance...

Ngày tải lên: 16/03/2014, 11:20

13 456 0
Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

... Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of SOCS3 translated from an alternative initiation AUG ... autoinhibitory mechanism Cell 86, 577–587 Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN et al (1999) The JAK-binding protein JAB inhibits ... functional analysis In addition to their role in blocking the activation of downstream signalling intermediates, the SOCS proteins may also act by directing the degradation of bound signalling molecules...

Ngày tải lên: 16/03/2014, 14:20

11 525 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

... containing a stable hairpin in the 5¢UTR (pIFNHAhp, Fig 2) and the deadenylation of the derived mRNA was compared to that of the mRNA lacking such a secondary structure (pIFNHA) As shown in Fig ... and plasminogen activator inhibitor (PAI-2) messenger RNAs are other ARE-containing mRNAs bearing instability determinants in their coding region [24–27] Moreover, in the case of c-fos, it was ... shown that ARE mediates mRNA deadenylation by a translationindependent mechanism, while the coding region instability determinant facilitates mRNA deadenylation by a mechanism coupled to translation...

Ngày tải lên: 17/03/2014, 10:20

8 361 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

... phenotypes share the same b-chain containing 245 amino acid residues As shown in Fig 1A, the a1 -chain containing 83 amino acid residues possesses two available )SH groups; that at the C-terminus always ... Schematic drawing of the human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always links to a b-chain ... cross-links with a b-chain to form a basic a- b unit, and that at the N-terminus links with another (a- b)1, resulting in an Hp dimer (a1 -b)2, i.e a Hp 1-1 molecule In contrast, the a2 -chain, containing...

Ngày tải lên: 23/03/2014, 07:20

13 527 0
Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

... chemiluminometer (Lumac, AC Landgraaf, The Netherlands) To generate aDlNa+, the proteoliposomes were first loaded with Na+ to create a DpNa The vesicles were incubated in buffer D containing, in addition, ... Germany) (A) or blotted against specific antibodies (B) Lane 1: molecular mass marker Lane 2: ATP synthase preparation was denatured by incubation at 80 °C for 10 Lane 3: ATP synthase was heated ... protein))1Æmin)1 When a DY was applied separately, ATP was synthesized at a rate comparable to that with electrochemical sodium ion potential (DlNa+) as the driving force ATP synthesis was strictly...

Ngày tải lên: 23/03/2014, 09:20

8 486 0
tiểu luận managing successful organizational change in the public sector

tiểu luận managing successful organizational change in the public sector

... thuyết thay đổi tổ chức tổ chức công (Theories about Organizational change in Public Organization)  Các nhân tố đóng góp vào thay đổi thành công (Factors contribute to successful change) LÝ ... lý cấp cao (Ensure Top-Management Support and Commitment)  Sự cam kết hỗ trợ từ quản lý cấp cao đóng vai trò quan trọng cho thành công  Tầm quan trọng tác nhân thay đổi (single change agent) ... để thay đổi vượt qua kháng lực (Build internal support for change and Overcome resistance)  Các nhà lãnh đạo phải xây dựng hỗ trợ nội để thay đổi làm giảm kháng lực với thông qua tham gia rộng...

Ngày tải lên: 16/04/2014, 02:30

20 480 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

... Ethics and the law The second was the action where the Coca-Cola Corporation were also successful in forcing the supermarket chain, Sainsbury’s, to change the appearance – the ‘get-up – of their ... includes the type, size and shape of a container, the labelling and packaging of the goods concerned Many well-established firms such as the Kellogg Corporation, CPC International Inc (the makers ... original illustrations) it must be ‘camera ready’ (see page 36) Normally, finished drawings or paintings are acceptable, but cartoons and sketches must be in ink, with perhaps an optional ‘wash’ background...

Ngày tải lên: 21/06/2014, 14:20

17 503 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

... as a garden, an interior, the front of a building, or a building site Weather watching On the day, a ‘weather watch’ may be needed if there is any question about the weather holding Delays mean ... location or time Other specialist journals and trade magazines, such as Ad-line, PR Week, Campaign or Photography Today, may also provide useful names and contacts, as may the Royal Photographic ... collected and returned and that dressing-room facilities, or the equivalent, may be needed External locations These need advance planning in more detail Again, a reconnaissance before the day to...

Ngày tải lên: 21/06/2014, 14:20

17 433 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_3 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_3 doc

... setting and have a formal agenda, at least for part of the meeting The adoption of the previous minutes, chairman’s address, presentation and adoption of the annual accounts and the appointment ... material, a standard facia board over the front with your organization’s name and stand number, some sort of flooring, a ceiling and basic lighting Make sure the correct details are on the facia The ... event, but also in the staffing and in the implementation After all, you are presenting, or even selling, a professional service on the stand, so why so in an amateurish way? Bad planning and slipshod...

Ngày tải lên: 21/06/2014, 14:20

17 411 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_5 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_5 docx

... the printed word, broadcast messages are somewhat difficult to retain However, they have an instant impact, eg a natural disaster such as an earthquake But because of their transience, broadcast ... Crisis management: establish crisis centre Public relations – a practical guide of food poisoning, a bomb at a mainline railway terminus, a fire in a shopping precinct These are the sorts of scenarios ... the Media The media, or broadcast media as it is usually called, is different from the press It has special advantages and disadvantages Radio and television have one thing in common: they are both...

Ngày tải lên: 21/06/2014, 14:20

17 453 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_6 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_6 doc

... conversations – the least accurate but sometimes indicative Analysis The analyst (that is the PRO) then has to examine all the material collected, analysing and classifying it so that a report can ... Conclusion The many changes in attitudes that have taken place in our society in recent years, with an increasing demand for information, the questioning of decision making and the increasingly voracious ... act as an early warning system for any ‘overruns’ that may occur, and can also be used as a ‘benchmark’ for any future work They also help in calculating fees A secretariat can collect and then...

Ngày tải lên: 21/06/2014, 14:20

17 458 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_7 ppt

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_7 ppt

... can include the container, the labelling and often the packaging However, if the products are in different areas of trade then no legal action can be taken Examples of this are in the use of the ... by making available to the Consultancy all relevant information 117 319 app 3.p65 117 13/06/00, 12:59 Appendix Consultancy status The Consultancy acts in all its contracts as a principal at law ... has gained in the course of its appointment Insurance 9.1 Professional indemnity The Client shall indemnify and keep indemnified the Consultancy from and against any and all proceedings, claims,...

Ngày tải lên: 21/06/2014, 14:20

17 471 0
w