1990 quot acute pesticide poisoning a major global health problem quot world health stat q 43 3 139 44

EXPOSURE TO AIR POLLUTION: A MAJOR PUBLIC HEALTH CONCERN docx

Ngày tải lên : 23/03/2014, 02:20

... attributable to selected major risks Geneva, World Health Organization (http://www.who.int/healthinfo /global_ burden_disease/GlobalHealthRisks_report_full.pdf) WHO (2008) Air quality and health Geneva, ... World Health Organization (WHO) air quality guidelines2 ,3, 5,6 Particulate matter with a diameter of 2.5 µm or less (PM 2.5 ) 10 µg/m3 (annual mean) 25 µg/m3 (24 h mean) Particulate matter with a ... hospital treatment, and increased risk of death from cardiovascular and respiratory diseases or lung cancer Particulate matter is estimated to cause about 8% of deaths from lung cancer, 5% of deaths...

6
401
1

bank failures in the major trading countries of the world causes and remedies phần 3 docx

Ngày tải lên : 10/08/2014, 07:21

... growth, stable and low inflation, large movements of capital and labour across borders and exchange rate stability After World War I, there was an international attempt to restore the gold standard, ... European financial markets ( ) Third, and perhaps most importantly, large capital flows made possible by the integration of financial markets were diverted towards real estate markets in several ... making comparisons across time Although the statistical data from previous epochs are far from complete, historical national accounts research and the statistics compiled by the League of Nations...

10
338
0

Báo cáo sinh học: "Including Emergency and Acute Care as a Global Health Priority" doc

Ngày tải lên : 18/06/2014, 18:20

... coordination of the research effort, and the drafting and editing of the manuscript All authors read and approved the final manuscript Authors’ information The International Acute Care Research ... Research Collaborative (IACRC), located within the University of Maryland Global Health Initiative, is dedicated to saving lives through improvement in the global access and quality of acute care services ... Emergency and Acute Care as a Global Health Priority Authors: Nicholas Risko, MHS University of Maryland School of Medicine 655 W Baltimore Street, Baltimore MD 21201, USA nicholas.risko@som.umaryland.edu...

5
274
0

báo cáo hóa học: " Complications and management of acute copper sulphate poisoning; A case discussion" pot

Ngày tải lên : 20/06/2014, 00:20

... Complications and management of acute copper sulphate poisoning; A case discussion Champika SSK Gamakaranage, 2Chaturaka Rodrigo, 3Sajitha Weerasinghe, 2Ariaranee Gnanathasan, 4Visvalingam Puvanaraj ... toxicity [2, 5] Two major haematological manifestations of copper sulphate poisoning are intravascular haemolysis and methaemoglobinaemia[1] Intravascular haemolysis can start as early as within the ... CSSKG: champikasri@gmail.com CR: chaturaka.rodrigo@gmail.com SW: sajithaw@yahoo.com AG: ariaranee2000@yahoo.com VP: vpuvanaraj@yahoo.co.in HF: harshi.fernando39@gmail.com Abstract Copper sulphate...

17
340
0

Báo cáo hóa học: " Including Emergency and Acute Care as a Global Health Priority" potx

Ngày tải lên : 20/06/2014, 01:20

... coordination of the research effort, and the drafting and editing of the manuscript All authors read and approved the final manuscript Authors’ information The International Acute Care Research ... Research Collaborative (IACRC), located within the University of Maryland Global Health Initiative, is dedicated to saving lives through improvement in the global access and quality of acute care services ... Emergency and Acute Care as a Global Health Priority Authors: Nicholas Risko, MHS University of Maryland School of Medicine 655 W Baltimore Street, Baltimore MD 21201, USA nicholas.risko@som.umaryland.edu...

5
327
0

Báo cáo toán học: " Including emergency and acute care as a global health priority" potx

Ngày tải lên : 20/06/2014, 21:20

... effort, and the drafting and editing of the manuscript All authors read and approved the final manuscript Authors’ information The International Acute Care Research Collaborative (IACRC), located ... utilizing a common language, and increasing our interaction with the global health community, we can grow from clinicians into advocates, helping bring attention to the critical and permanent role acute ... emphasize how acute care plays a crucial function in the simple prevention of death and disability that primary care is not positioned to provide Additionally, it is critical that global leaders...

2
198
0

Báo cáo y học: "Prolonged N-acetylcysteine therapy in late acetaminophen poisoning associated with acute liver failure – a need to be more cautious" docx

Ngày tải lên : 13/08/2014, 16:20

... Murray L, Graudins A, Buckley NA: Guidelines for the management of paracetamol poisoning in Australia and New Zealand - explanation and elaboration: a consensus statement from clinical toxicologists ... Dawson AH: Safety and efficacy of intravenous N-acetylcysteine for acetaminophen overdose: analysis of the Hunter Area Toxicology Service (HATS) database Curr Med Res Opin 2007, 23: 235 9- 236 8 Gawarammana ... hepatocellular recovery In the management of late presenters with APAP poisoning and APAPinduced liver failure, clinicians may have to consider individual case scenarios in tailor-making duration...

2
278
0

Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Setup in Lusaka, Zambia

Ngày tải lên : 14/11/2016, 19:49

... height, and age were numeric data but were grouped as categorical data for purposes of analysis During the analysis, a variable called “nutstat” was created based on a combination of children’s admission ... consume RUTF Data analysis Variables in the dataset included binary (sex, HIV, fever, WHZ score

19
324
0

Tài liệu GLOBAL HEALTH TRAINING IN GRADUATE MEDICAL EDUCATION: A Guidebook ppt

Ngày tải lên : 14/02/2014, 09:20

... Jayarman et al Global Health in General Surgery Residency: A National Survey J Am Coll Surg, March 2009;208 (3) :426 -33 23 Sawatsky et al Eight Years of Mayo International Health Program: What an ... Grumbach, L Masae Kawamura, James H McKerrow, Stephanie Tache and Anthony Valdini 117 10 Profiles of Global Health Programs Jack Chase, Laura Janneck, and Michael Slatnick 130 11 Physician Assistants ... that research can pose Domestic Educational Experiences in Global Health Over the last decade, international health has evolved into global health as a result of increased globalization and also...

197
409
0

Tài liệu Developing Residency Training in Global Health: A Guidebook ppt

Ngày tải lên : 14/02/2014, 09:20

... several global health training initiatives at the school, including global health tracks within the medical school and a Master of Public Health Program Global health training for residents was launched ... them and affect their careers and personal lives Graduates from the Global Health Track have gone on to work in just about every area of health care, including academic pediatrics, humanitarian aid, ... behavioral determinants of health; demography; social justice and global health including an understanding of human rights; staying healthy during the global health field experience; global health...

119
362
0

Tài liệu Indoor air pollution in developing countries: a major environmental and public health challenge doc

Ngày tải lên : 17/02/2014, 22:20

... biomass smoke is a potential risk factor for lung cancer Nasopharyngeal and laryngeal cancer Biomass smoke has been implicated as a cause of nasopharyngeal carcinoma (100), although this is not a ... a las establecidas como referencia por la ´ Agencia para la Proteccion del Medio Ambiente de los ´ Estados Unidos La exposicion a esa contaminacion ´ ´ afecta principalmente a las mujeres y a ... sı´ntomas) ´ ´ y la enfermedad pulmonar obstructiva cronica ´ (evaluada clı´nicamente y mediante espirometrı a) , sobre todo entre las mujeres, algunas de las cuales acaban desarrollando enfisema o...

15
551
1

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Ngày tải lên : 19/02/2014, 07:20

... 5¢-AAACATAAATTTCGCCATTTCTCCTAG TAT -3 The full-length mouse cDNA was obtained with primers 4x1-f-pF, 5¢-ATGGAGGCCTCCTGGCTGGAG ACTCGTTGG -3 and 4x1-f-pR, 5¢-AAACATAAATTT CGCCATTTCTCCTAGTAT -3 Total RNA from mouse brain ... in bacteria A probe for RNAase protection for mouse Cyp4x1 was obtained by PCR of brain RNA with primers 4x1-12-pF, 5¢-CATGGACATAAGTCCTTTTCCCTTCCTCCT -3 , and 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG ... function Experimental procedures Animals and tissue Human cardiovascular system and 12-lane multitissue northern blots, human aorta cDNA library and RACE ready aorta cDNA were obtained from Clontech...

12
466
0

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Ngày tải lên : 20/02/2014, 01:20

... MIR-D40 (Sanyo, Osaka, Japan) To amplify the DNA fragments containing a complete x-5 gliadin gene, oligonucleotides, 5¢-AAGTGAGCAATAGTAAACACAAATCAAAC -3 and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG -3 , ... immunoassay for inhibition test Expression and puriﬁcation of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA -3 ) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC -3 ) ... gliadin, a major allergen in wheatdependent exercise-induced anaphylaxis J Biol Chem 279, 12 135 –12140 Morita E, Matsuo H, Mihara S, Morimoto K, Savage AW & Tatham AS (20 03) Fast x-gliadin is a major...

8
484
0

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

Ngày tải lên : 22/02/2014, 07:20

... isolated as follows Approximately 500 000 lysis plaques of a Chlamydomonas kZAP II cDNA library were screened with antisera SA 137 C and PA55 as described by Sambrook et al [30 ] A cDNA clone (named ... for h at 37 °C Whereas all STA2 strains display a 4.0 kb band that speciﬁcally hybridizes with probe CD142, all sta2–29::ARG7 mutant strains lack this band 137 C and CS9 are wild-type strains from ... speciﬁc activities (activity vs amount of starch) were measured in comparison with potato, cassava, taro and wheat, the Chlamydomonas enzyme appeared at least 10-fold more active than the most active...

11
556
0

The ‘global health’ education framework: a conceptual guide for monitoring, evaluation and practice doc

Ngày tải lên : 05/03/2014, 22:21

... global in global health: a dialectic approach Globalization and Health 2010, Beaglehole R, Bonita R: What is global health? Glob Health Action 2010, Development Assistance Committee: Glossary ... transborder and global determinants Towards health for all’ **/+ Learning opportunities in global health should adopt and impart the ethical and practical aspects of achieving health for all’ ... Smith A, Maini A, Martin S, Miranda JJ, Pollit V, Wake R, Willott C, Yudkin JS: Global Health and medical Bozorgmehr et al Globalization and Health 2011, 7:8 http://www.globalizationandhealth.com/content/7/1/8...

12
884
0

GLOBAL HEALTH RISKS: Mortality and burden of disease attributable to selected major risks doc

Ngày tải lên : 14/03/2014, 09:20

... GLOBAL HEALTH RISKS Mortality and burden of disease attributable to selected major risks World Health Organization WHO Library Cataloguing-in-Publication Data Global health risks: mortality and ... associated with maternal conditions and around 90% of unsafe abortions globally Globally, lack of modern contraception caused around 0 .3% of deaths and 0.8% of DALYs Africa, South-East Asia and ... GBD report assumed that 60% of anaemia was due to iron deficiency in non-malaria areas and 50% in malaria areas (2) Deaths and DALYs estimated for the global burden of disease cause category “iron-deficiency...

70
594
0

Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx

Ngày tải lên : 14/03/2014, 21:20

... Commentary Journal of the American Medical Association, 30 0(20), 2422-2424 Canadian Nurses Association (2010, December) Nursing Education in Canada Statistics, 20082009 Available online at http://www.cnaaiic.ca/CNA/documents/pdf/publications/Education_Statistics_Report_2008_2009_e.pdf ... global and national organizations to raise awareness of the key role of nurse education in the improvement of global health and quality of care See http://www.ganes.info GANES Members American ... Agreement Nurses and midwives represent around 50% of Australia’s health workforce, though the availability of clinicians varies greatly in urban and remote areas New Zealand has a total nursing workforce...

6
562
0

Global Health in Medical Education: A Call for More Training and Opportunities pptx

Ngày tải lên : 14/03/2014, 21:20

... A core curriculum for international health: evaluating 10 year’s experience at the University of Arizona Acad Med 1992;67:90–94 42 International Health Group Global Health Pathway Available at: ... Global Health 2005;1 :3 Global Forum for Health Research 10/90 Report on Health Research 20 03 2004 Geneva, Switzerland: Global Forum for Health Research; 2004 World Health Organization The World Health ... World Health Report 20 03 Geneva, Switzerland: World Health Organization; 20 03 229 Global Health Mathers CD, Iburg KM, Salomon JA, et al Global patterns of healthy life expectancy in the year 2002...

5
640
0

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase puriﬁed from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

Ngày tải lên : 16/03/2014, 12:20

... APN3 AAX39865 Tni APN3 AAN75694 Har APN2 AAF37560 Hpu APN3 AAF99701 Epo AAD311 83 Ldi APN1 AAC36148 Pin AAK58066 Hvi AAL 839 43 Bmo APN3 AAF37559 Hpu APN2 AAB70755 Pxy AAK69605 Sli AAF08254 Hvi AAX39866 ... AAX39866 Tni APN4 AAN756 93 Har APN1 AAF37558 Hpu APN1 BAA 337 15 Bmo Family Family AAX398 63 Tni APN1 AAC 333 01 Bmo Q11001 Mse CAA10950 Pxy P91885 Mse APN2 BAA32140 Bmo 0.1 AAD31184 Ldi APN2 A pisum ... (GenBank accession number AAL 839 43) [17] and APN4 (BmAPN4) (GenBank accession number BAA 337 15); Epiphyas postvittana, Epo, APN(EpAPN) (GenBank accession number AAF99701) [ 13] ; Lymantria dispar,...

15
391
0

Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Ngày tải lên : 16/03/2014, 18:20

... within a day, making a sharp contrast to the cases of typical PPARa-target genes so far studied [3, 13, 21] Transcription of the peroxisomal hydratase-dehydrogenase (HD) and L-FABP genes is activated ... underlined; GenBank accession number AK04 935 5); 5¢-GGGAATTCGACGGGCGTGTGGTGTTGGTCA3¢ and 5¢-GGCTCGAGGAAGTGGCTTATACAGCTC CAA -3 for 17b-HSD-4 (corresponding to nucleotide numbers 43 12 73 of the published ... transcriptional start site did not respond to a PPARa ligand Wy14 6 43 in the reporter gene assay (data not shown) Although an essential role of PPARa in the ligand-dependent transcriptional activation...

6
272
0