19 handle namespaces in xml returned by a service
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling
Ngày tải lên :
05/09/2013, 09:38
... total bacterial count in the untreated water dropped rapidly at first stage and slowly at second stage in the SC-CO2 treatment and the inactivation rate increased as the temperature increased ... SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa et al (1996) reported that enzyme inactivation by the SC-CO2 ... embedded in 1% agar, dehydrated using an ethanol series and embedded in Epon 812 Ultra-thin sections were doubly stained with uranyl acetate and lead nitrate and then examined with a JEM-1200 EX transmission...
10
451
1
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
Ngày tải lên :
16/03/2014, 05:20
... ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG ... of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, ... into the XbaI site of pBOS Vector pBOS-Myc and pBOSFlag were constructed similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢...
9
420
0
Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt
Ngày tải lên :
30/03/2014, 01:20
... fragments obtained with primers CarBG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAA ATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACA CCGTTTG-3¢) The presence of the carB36 mutation was checked using a FokI (Takara ... Paisley, UK) following the manufacturer’s instructions Two microlitres of cDNA were used for the amplification of carB using the primers 5¢-ATGAGCGACATTAAGAA ATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACAAG-3¢ ... Normalization and quantification were performed using an internal a- tocopherol acetate standard according to Hoa et al [69] Carotenoid amounts were calculated according to a b-carotene standard curve Peaks...
16
440
0
Báo cáo hóa học: " Updated survivals and prognostic factor analysis in myeloma treated by a staged approach use of bortezomib/thalidomide/dexamethasone in transplant eligible patients" pot
Ngày tải lên :
18/06/2014, 16:20
... IgG/lambda from free lambda) One developed a double IgG/kappa from a single IgG/kappa, and two patients had complete change of paraprotein (one from IgA/kappa to IgG kappa, and one from IgD/lambda ... appearance of a new paraprotein persisting for ≥ weeks, was demonstrated in six patients [5] Three patients with light chain myeloma developed a IgG paraprotein (two IgG/kappa from free kappa, ... protocol was approved by the institution review board in accordance with the Declaration of Helsinki, and informed consent was obtained from all participating patients The treatment algorithm was shown...
7
489
0
Báo cáo y học: "α Does protein kinase R mediate TNF-α- and ceramide-induced increases in expression and activation of matrix metalloproteinases in articular cartilage by a novel mechanism" pps
Ngày tải lên :
09/08/2014, 01:23
... complementary DNAarray technology Arthritis Rheum 2001, 44:2777-2789 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases ... metalloproteinase and metalloproteinase inhibitor imbalance in human osteoarthritic cartilage J Clin Invest 1989, 84:678-685 Aigner T, Zien A, Gehrsitz A, Gebhard PM, McKenna L: Anabolic and catabolic ... penicillin and 10 µg/ml streptomycin In vitro cartilage samples Cartilage was taken from the metacarpophalangeal joint of 7-day-old bovine calves within 12 hours of slaughter using a scalpel and...
10
379
0
Báo cáo y học: " Haemoptysis in pregnancy caused by a well-differentiated fetal adenocarcinoma: a case report" docx
Ngày tải lên :
11/08/2014, 14:21
... Well-differentiated fetal adenocarcinoma (WDFA) is classified by the World Health Organisation as a variant of adenocarcinoma When fetal adenocarcinoma is associated with primitive blastemal stroma, it ... months after delivery Chest 2006, 130:1620-1623 Nakatani Y, Masudo K, Nozawa A, Inayama Y, Yamanaka S, Ito T, Kitamura H, Notohara K, Kashima K, Yokoyama S, Tsujimoto M, Tamai S, Abe Y, Resl M, Mark ... logical explanation, it is important to seek advice from a senior respiratory physician, and consider undertaking a CTPA, both of which can play a vital role in identifying rare but life threatening...
4
258
0
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
Ngày tải lên :
23/09/2012, 15:38
... economics had manual incinerator In other hospitals, the manual incinerator is burned and leaves an uncomfortable smell According to the “Regulation of medical waste management” of the Ministry ... Public Health, medical waste must be treated immediately at once, contained in bag or barrel according to color and standard In fact, in most hospitals, especially in private medical stations, ... premises Medical wastes include injurious medical wastes and common wastes Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors...
10
722
0
Tài liệu Write better essays in just 20 minutes a day part 19 pptx
Ngày tải lên :
21/01/2014, 16:20
... desk Teacher confronting class People deciding it was Pearl who told on them Begin mean to Pearl Feeling guilty Telling Rob Walking into cafeteria and having people make fun of me People avoiding ... 179 – ANSWER KEY– Practice Here’s an outline for the same freewriting exercise using cause and effect as the main organizing principle How I came to be called “The Rat”: Start with walking into ... rather be made fun of for wearing the same clothes all the time than for wearing the cheap, no-name gear that made up most of her wardrobe At least these outfits gave her a shot at hanging out with...
10
367
0
A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong
Ngày tải lên :
05/02/2014, 22:02
... then Situational Language Teaching represented the major British Approach to teaching English as a foreign language In Situational Language Teaching, language was taught by practising basic structures ... increasing students' participation in large classes in Vietnam, particularly in higher institutions The above situation of teaching large classes and the gap of knowledge in the research area ... theoretical assumption underlying Situational Language teaching (Richards and Rodgers 1991:64) As the scope of Communicative Language Teaching has expanded, it was considered as an approach rather than...
42
616
2
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
Ngày tải lên :
15/02/2014, 13:20
... are rare (Table 1) (42 ) BCG vaccinations are usually administered by the intradermal method, and reactions that can be expected after vaccination include moderate axillary or cervical lymphadenopathy ... States This vaccine was transferred from a strain that was maintained at the University of Montreal (Montreal, Canada) Vaccine Efficacy Reported rates of the protective efficacy of BCG vaccines ... vaccine strain, and method of vaccine administration Case reports have indicated that BCGrelated lymphadenitis, local ulceration, and disseminated BCG disease—which can occur several years after...
27
1.3K
3
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc
Ngày tải lên :
19/02/2014, 06:20
... the MAP kinase cascade [49] Our study showed that EGF caused a substantial increase in AP1 DNA binding In addition, this increase was prevented by MAP kinase kinase inhibitor PD98059 (Fig 5A) The ... described in (A) Lysates were prepared at the indicated times after the ADR addition and analyzed for caspase activity by using a fluorometric substrate-based assay Each point is the mean of triplicate ... cDNA that had been labeled with [32P]dCTP by use of a Rediprime II DNA Labeling System (GE Healthcare) Caspase activity assay Caspase activity was examined according to the instruction manual of...
13
493
0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... production, indicating that TS activated a LPS-stimulated signal pathway (Fig 4) PKC is a key kinase in the LPSstimulated signal pathway [30,31] The findings that PKC inhibitors, not PKA inhibitors, inhibited ... the antioxidants BHA and AsA These results suggested that active oxygens and free radicals did not participate in the TS effect, and that the inhibitory effect of a- T was mediated by a nonantioxidative ... of a- tocopherol in smooth muscle cells J Nutr 131, 378S– 381S Badamchian, M., Spangelo, B.L., Bao, Y., Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog...
6
494
0
Contemporary Issues in Bioethics Edited by Peter A. Clark pdf
Ngày tải lên :
08/03/2014, 00:20
... or in that of any other, in every case as an end and never merely as a means” According to Kant human beings as rational agents embody the supreme moral law and have intrinsic moral worth, and ... twin needs of clinical trainees to develop both in clinical skill as well as in character and moral habit By introducing this perspective into the framework already provided by Utilitarian and ... as adequate pain management for cancer patients are available in abundance in developed countries but are lacking miserably in developing countries Patients in many developing countries are sent...
162
406
0
Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf
Ngày tải lên :
08/03/2014, 09:20
... LEA B napus cv Westar were aligned Amino acid residues at position 282 are shaded in black and indicated by the black arrow The amino acid residues at position 303 are indicated by the white arrow ... elongases have a serine amino acid residue at that position, in the catalytically inactive protein from LEA cv Westar serine 282 is substituted by phenylalanine (Fig 1) Fig Alignment and comparison ... from A thaliana FAE1 (accession number AF053345), HEA B napus cv.s Golden and Ascari (accession numbers AF00953 and AF274750), HEA B napus cv Hero, B oleracea MDE line 103, B rapa MDE line R500 and...
7
381
0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
Ngày tải lên :
08/03/2014, 23:20
... stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton ... CoA CoB CoC DaB EaA EaB EsB FhA FhB HaA HaB HoA HoB HoC HvB HvC MaA MaB MaC MbA MbB MbC Md MhB MhC MhD Mn MoA MoB MrB Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou ... kame terrace Glaciolacustrine originating as a blanket formation and a deltaic formation Colluvium originating on a kame terrace Organic swamp originating as a blanket formation Residuum originating...
131
599
0
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot
Ngày tải lên :
16/03/2014, 02:20
... C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2 [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A Balazs, ... designated as the proline-rich domain (PRD) in this work Caskin1 can bind the Cask adaptor protein [1], Abl-interactor-2 (Abi2), and another nine proteins shown in this work, and is presumably involved ... Caskin1, and of scaffold proteins in general, are discussed Results Structural characterization of Caskin1 fragments As described in the introductory paragraphs, the N-terminal half of Caskin1...
13
408
0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
Ngày tải lên :
16/03/2014, 06:20
... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia ... post-translational modification shown to affect several parameters including: (a) stability and turnover by interfering with or promoting proteolysis [32,33], (b) activating or inactivating enzymes...
14
454
0
Xem thêm