... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... Structural dynamics and serine protease catalysis Table Global energetic parameters and DebyeWaller temperature factors calculated for the protein portion of a- CT and the various lactose -a- CT conjugate...
Ngày tải lên: 19/02/2014, 05:20
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
... chemical baselines Cpex, expression of the partial heat capacity of the protein relative to the heat capacity of the protein in the native state the monomerization of the dimer), and the latter ... for the putative mechanism of domain- swapping dimerization of RNase A and the human pancreatic ribonuclease variant, PM8 For RNase A (A) , the protein is subjected to conditions that favour the ... the same conditions as the sample and by subtracting the chemical baseline using the method of Takahashi & Sturtevant [33] Enzymatic activity measurements Assessment of the extent of the domain- swapping...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... peptides These linker peptides may allow hinge movements of the association domain against the carboxyltransferase and the biotin domain The dynamics of conformational motions within the catalytic ... between the a- and c-subunits and dissociation at acidic pH A detailed analysis of the interaction of the C-terminal domain of the c-subunit with the a- subunit was performed using the recombinantly ... motif of the oxaloacetate decarboxylase c-subunits from K pneumoniae and V cholerae The sequences of the c-subunits of the oxaloacetate decarboxylases from K pneumoniae and V cholerae are compared...
Ngày tải lên: 23/03/2014, 13:20
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
Ngày tải lên: 12/09/2012, 15:05
List the components of a radio system
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...
Ngày tải lên: 13/09/2012, 10:52
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
Ngày tải lên: 21/09/2012, 10:39
Guest the meaning of a word
... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...
Ngày tải lên: 02/10/2012, 12:07
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the state [11] This is a quasi-experimental...
Ngày tải lên: 25/10/2012, 11:00
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... engages mainly in the industry of household appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances ... Generally, if possible, it is wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade ... days after of the buyer’s advice ARTICLE 8: ARBITRATION During the performance of the contract, if any dispute arises, the parties shall discuss to find solution in an amicable way If the parties...
Ngày tải lên: 18/04/2013, 08:57
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater
... water ascends to the top of the tank It is originated from the fact that, after gaining heat from the solar radiation, the tank wall heats a thin vertical layer of water along the tank wall Part ... function of the density, specific heat capacity and the initial and massweighted average temperatures of water; with all the values, apart from the mass-weighted average temperature, are the same ... solar radiation and average temperature of the present experimental study and the theoretical results of [1] in January Figure 12 The time variation of solar radiation and stored energy of the...
Ngày tải lên: 05/09/2013, 15:28