1 b the whole enterprise of risk assessment is socially constructed meaning that it has no independent validity or objectivity

THE WHOLE HISTORY OF GRANDFATHER''''S CHAIR pptx

THE WHOLE HISTORY OF GRANDFATHER''''S CHAIR pptx

Ngày tải lên : 17/03/2014, 15:20
... the story of this remarkable chair cannot be told without telling a great deal of the history of the country So Grandfather talked about the Puritans, {Foot Note: It is more precise to give the ... Israel would now learn the history of their forefathers That grace which the ancient Israelites had forfeited was offered anew to their children There is no impiety in believing that, when his ... World of the west Since the first days of Christianity, there has been no man more worthy to be numbered in the brotherhood of the apostles than Eliot "My heart is not satisfied to think," observed...
  • 106
  • 323
  • 0
Financing Pulp Mills An Appraisal of Risk Assessment and Safeguard Procedures potx

Financing Pulp Mills An Appraisal of Risk Assessment and Safeguard Procedures potx

Ngày tải lên : 18/03/2014, 02:20
... Fitch IBCA Spread Change 1D 1W 1M YTD BBB 14< /b> 7 +7 +0 +6 +8 BB 274 +6 +6 +9 +5 B 512< /b> -0 + 22 + 10< /b> - 11< /b> + 12< /b> 7 Brazil B+ B2 B+ 538 + 65 + 36 + 65 Chile A Baa1 A- 10< /b> 0 -2 +1 < /b> -7 +3 Indonesia B B2 B+ ... -1 < /b> + 30 + 33 + 49 Russia BB+ Baa3 BB+ 266 +1 < /b> +5 + 13< /b> + 11< /b> Thailand BBB Baa1 BBB 53 -7 - 11< /b> - 15< /b> - 22 Source: Deutsche Bank debt price sheet Mar-04 Country spread levels are the deciding factor ... Employees/ tonne of P &B Companies in the top 15< /b> 0 14< /b> 10< /b> 32 11< /b> 5 2 11< /b> ,475 28,649 9 ,11< /b> 8 - 33,300 10< /b> ,7 71 < /b> 57 ,14< /b> 9 11< /b> 3,977 67,209 6 21,< /b> 372 82,8 51 < /b> 65,500 13< /b> ,328 13< /b> ,14< /b> 5 8,474 22,273 2,454 2,485 1,< /b> 685 56, 614< /b> 4,357...
  • 104
  • 280
  • 0
owen b. the organ music of j. brahms

owen b. the organ music of j. brahms

Ngày tải lên : 04/06/2014, 15:41
... 12< /b> 1 Editions 13< /b> 9 The Organs in Brahms’s World 14< /b> 2 Organ Transcriptions of Works by Brahms Notes 15< /b> 5 Bibliography 16< /b> 7 Discography 17< /b> 7 Index 17< /b> 9 15< /b> 1 This page intentionally left blank pa rt i background ... Orgel ad libitum: it appears to be rather unimportant whether the organ is used or not According to a recollection of the publisher, the ad libitum was placed there because at the time the work ... authenticated as having been written by Brahms, exist for this work It is obvious that the organ plays an important role in the Triumphlied, which begins with three forte chords for organ and orchestra,...
  • 197
  • 165
  • 0
against the gods-the remarkable story of risk - peter bernstein

against the gods-the remarkable story of risk - peter bernstein

Ngày tải lên : 11/07/2014, 22:17
... Considering the Nature of Man 99 The Search for Moral Certainty 11< /b> 6 The Supreme Law of Unreason 13< /b> 5 The Man with the Sprained Brain 15< /b> 2 10< /b> Peapods and Perils 17< /b> 2 11< /b> The Fabric of Felicity 18< /b> 7 19< /b> 00 -19< /b> 60: ... probability theory He defined, for the first time, what is now the conventional format for expressing probability as a fraction: the number of favorable outcomes divided by the "circuit" -that is, ... also a risky business As the growth of trade transformed the principles of gambling into the creation of wealth, the inevitable result was capitalism, the epitome of risk- taking But capitalism could...
  • 318
  • 441
  • 0
Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf

Báo cáo khoa học: "Increased phosphorylation of caveolin-1 in the spinal cord of irradiated rats" pdf

Ngày tải lên : 07/08/2014, 20:23
... [7] IL -1< /b> induces the phosphorylation of caveolin -1 < /b> in HIT-T15 cells [12< /b> ] Therefore, it is highly probable that IL -1< /b> induces the phosphorylation of caveolin -1 < /b> in the microglia, leading to the inflammatory ... sequentially with primary rabbit anti-p-caveolin -1 < /b> followed by fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG (1 < /b> : 50 dilution; Sigma, USA) The sections were then incubated with anti-GFAP ... with biotinylated IB4 (Sigma, USA), followed by TRITC-labeled streptavidin (Zymed, USA) Next, the sections were then reacted with the rabbit anti-p-caveolin -1,< /b> followed by a reaction with FITC-labeled...
  • 5
  • 205
  • 0
Báo cáo khoa học: " Expert opinion as ''''validation'''' of risk assessment applied to calf welfare" ppt

Báo cáo khoa học: " Expert opinion as ''''validation'''' of risk assessment applied to calf welfare" ppt

Ngày tải lên : 12/08/2014, 18:22
... risk of misinterpretation of the outcomes of this study When experts believe that one item, housing system or hazard, is better or more important than another, it does not logically follow that it ... The authors declare that they have no competing interests 10< /b> 11< /b> 12< /b> 13< /b> 14< /b> 15< /b> 16< /b> 17< /b> CAC (Codex Alimentarius Commission): Principles and Guidelines for the Conduct of Microbiological Risk Assessment ... expert Cited reference author Ethol 0 11< /b> 1 < /b> 12 11< /b> To determine main factor effects on the scores given by the experts, a components of variance model was used [19< /b> ], initially ignoring the fact that...
  • 12
  • 217
  • 0
Báo cáo khoa học: "The ethical analysis of risk in intensive care unit research" pdf

Báo cáo khoa học: "The ethical analysis of risk in intensive care unit research" pdf

Ngày tải lên : 12/08/2014, 20:20
... children, nontherapeutic risks are limited to a minor increase over minimal risk [8], that is, a minor increase over the ‘risks of daily life’ [9] It has been cogently argued that a similar degree of ... R: Minimal risk: the debate goes on Crit Care Med 2002, 30 :11< /b> 80 -11< /b> 81 < /b> Freedman B: Equipoise and the ethics of clinical research N Engl J Med 19< /b> 87, 317< /b> :14< /b> 1 -14< /b> 5 US Government: 45 – Code of Federal ... be consistent with competent clinical care More formally, it requires that at the start of the trial there exist a state of honest, professional disagreement in the community of expert practitioners...
  • 2
  • 160
  • 0
The information content of risk factor disclosures in quarterly reports

The information content of risk factor disclosures in quarterly reports

Ngày tải lên : 30/09/2015, 16:44
... β0 + β1QRFIit + β2LMVEit + β3BTMit + β4NEWSit + β5CAReait + it (1)< /b> CARfit was defined above QRFIit (quarterly Risk Factor information) is either UPDATERit or BB_WORDSit, as defined above For reference, ... either QFCSTERR _10< /b> it +1 < /b> or QFCSTERR_9 0it +1 < /b> QFCSTERR _10< /b> it +1 < /b> is an indicator variable equal to if forecast error falls in the bottom 10< /b> percent of the distribution of QFCSTERR it +1,< /b> and zero otherwise ... use both counts of the number of Risk Factors and the length of the 13< /b> Risk Factors section and find that the Risk Factors section disclosed in prospectus statements is related to both initial...
  • 110
  • 415
  • 0
4 1 5 the amazing geography of the west

4 1 5 the amazing geography of the west

Ngày tải lên : 26/04/2017, 10:35
... Illinois 60025 10< /b> V0G1 14< /b> 13< /b> 12< /b> 11< /b> 10< /b> 09 08 07 06 05 One of the best ways to explore the amazing land forms of the western United States is to visit a national park National parks are areas that ... part of the year Mountains and wildlife Grizzly bear cub 16< /b> Caribou 17< /b> Hawaii is a state with an amazing story The state of Hawaii is made up of many islands The Hawaiian Islands were formed by ... plants The best way to explore the exotic beauty of Death Valley is to visit Death Valley National Park The park is a little bigger than Death Valley itself For people who like reptiles, this is the...
  • 12
  • 212
  • 0
4 1 5 the golden age of sail (science)

4 1 5 the golden age of sail (science)

Ngày tải lên : 27/04/2017, 14:45
... China ISBN -10< /b> : 0-547-253 21-< /b> 4 ISBN -13< /b> : 978-0-547-253 21-< /b> 3 0940 18< /b> 17< /b> 16< /b> 15< /b> 14< /b> 13< /b> 12< /b> 11< /b> If you have received these materials as examination copies free of charge, Houghton Mifflin Harcourt School Publishers ... foaming as they crash against the ships The boys aren’t worrying about the hard work They aren’t even worrying about the dangerous sea They are too busy daydreaming They dream about a ship that can ... by Lisa M Cocca PHOTOGRAPHY CREDITS: (b) Digital Stock; 10< /b> (b) © Charles Smith/Corbis All other photos © Houghton Mifflin Harcourt Publishers All art © Houghton Mifflin Harcourt Publishers...
  • 18
  • 371
  • 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Ngày tải lên : 21/02/2014, 00:20
... BIOINBGU 3D-PSSM 12< /b> 3D+ 1.< /b> 20 .12< /b> 0.30 1.< /b> 20 .12< /b> 0 .10< /b> 1.< /b> 20 .12< /b> 0 .10< /b> 1.< /b> 10.490 .10< /b> 2.60.34 .10< /b> 1.< /b> 20 .12< /b> 0 .10< /b> 3.30.470.20 1.< /b> 10.260 .10< /b> 1.< /b> 20 .10< /b> 40.50 1.< /b> 20 .12< /b> 0 .10< /b> 1.< /b> 20 .12< /b> 0 .10< /b> 1.< /b> 10.238 .10< /b> 1.< /b> 20 .12< /b> 0 .10< /b> 1.< /b> 10.274 .10< /b> Table ... >10< /b> for BIOINBGU; 0 for 3D-PSSM; and >5.0 for 12< /b> 3D+ Method PDB Score CATH or SCOP Structural classification THREADER2 1vltB0 1cgo00 256bA0 1dkg b 1sctG0 1dg4A0 1jafA0 1gsa02 1g59 1fzp b 1b0 nA0 ... FUGUE; >10< /b> for BIOINBGU; 0 for 3D-PSSM; and >5.0 for 12< /b> 3D+ Method PDB Score CATH or SCOP Structural classification FFAS 1sctG0 1gcvA0 1dkg b 1aep00 1jafA0 1gln04 1qsdA0 1fzp b 2crxA1 1d7m a 256bA0...
  • 12
  • 550
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Ngày tải lên : 17/03/2014, 10:20
... possibility that substitution of C-terminal tyrosine of a-tubulin by 3nitrotyrosine alters the ability of the molecule to form microtubules For this purpose, we studied the behavior of nitrotyrosinated ... radioactivity was bound to a single protein with the same mobility as tubulin (Fig 1B, C) The nitrotyrosine molecule is bound to tubulin without modification before or after its incorporation, as it was ... nitrotyrosine of their respective incorporations indicates clearly that the two compounds are incorporated into tubulin at the same site Another biochemical characteristic of tubulin is its ability...
  • 9
  • 518
  • 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Ngày tải lên : 30/03/2014, 04:20
... PSD1 and RT-PCR described in this study The underlined sequences are homologous to the His3MX6 disruption cassette (OXA1-F1, OXA1-R1, PSD1-F1, PSD1-R1) or to the PSD1 ORF (PSD1-T1) Primer PSD1-U1 ... Primer PSD1-U1 is complementary to the region spanning the stop codon of the PSD1 ORF Primer Primer sequence (5¢- to 3¢) OXA1-F1 OXA1-R1 PSD1-F1 PSD1-R1 PSD1-T1 PSD1-U1 PSD1-RT FW PSD1-RT REV GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA ... tail export Recently, Mba1p was identified as a protein that interacts with the Oxa1p insertion machinery of the IMM [17< /b> ] Mba1p binds to the large subunit of mitochondrial ribosomes and thereby cooperates...
  • 11
  • 354
  • 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

Ngày tải lên : 31/03/2014, 01:20
... amount of dimeric form was found, as already observed for null mutants devoid of either subunit e or subunit g [14< /b> ,15< /b> ] It was previously shown that in the absence of subunit e, subunit g is not ... particles [17< /b> ] It has also been shown that in the absence of subunit e, subunit g is not present in mitochondria whereas the absence of subunit g in the null mutant DATP20 does not preclude the presence ... analysed by Western blot The blots were incubated either with antibodies raised against subunits e and i or with antibodies raised against subunits g and i cells of e19A, eG15L and eG19L strains...
  • 10
  • 550
  • 0